#sars-cov-2

Dr David Martin - Reiner Fuellmich Interview

3 days, 12 hours ago

"Proof that puts an end to the Sars-CoV-2 Narrative" - Professor Sucharit Bhakdi
Some good news and some troubling news, from Professor Sucharit Bhakdi, M.D.

2 weeks, 4 days ago

In a bombshell interview with Dr. Reiner Füllmich (Corona Ausschuss), Dr David E. Martin (M-CAM International) explains through a provable document trail, how patents were issued for all important genetic parts of SARS-CoV-2 so called "noval virus" years before the so called pandemic started in 2019.

The players include NIAID (Fauci), Basic (University of North Caroline), Peter Daszak (EcoHealth Alliance), Moderna, Sanofi, Pfizer, J&J and dozens of others in big pharma.

So, before we had the SARS-CoV-2 virus, before we had the accidental/purposeful/claimed "leak", before we had the pandemic, the world had:

- 73 patents on the all the important parts of the SARS-CoV-2 virus, including the "novel" furin cleavage, Spike Protein and other genetic features
- A test for the SARS-CoV-2 specific genetic virus
- A "cure" or "technology aka "injection" to treat the SARS-CoV-2 caused infection
- All this with detailed planning to MAKE THIS HAPPEN
- A plan to release a Global respiratory virus epidemic with a response that enables global PR campaign mass crowd control and a global coronavirus vaccine mandate
- This also includes the original SARS-COV, MERS and the current SARS-CoV-2 viruses
- All this in provable, written documents, planned in advance.

Some of the patents:

PN/6372224
https://patft.uspto.gov/netacgi/nph-Parser?Sect1=PTO2&Sect2=HITOFF&u=%2Fnetahtml%2FPTO%2Fsearch-adv.htm&r=1&p=1&f=G&l=50&d=PTXT&S1=6372224.PN.&OS=PN/6372224&RS=PN/6372224

PN/7220852
https://patft.uspto.gov/netacgi/nph-Parser?Sect1=PTO2&Sect2=HITOFF&u=%2Fnetahtml%2FPTO%2Fsearch-adv.htm&r=1&p=1&f=G&l=50&d=PTXT&S1=7220852.PN.&OS=PN/7220852&RS=PN/7220852

46592703P aka 7220852
https://patft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOFF&d=PALL&p=1&u=%2Fnetahtml%2FPTO%2Fsrchnum.htm&r=1&f=G&l=50&s1=7776521.PN.&OS=PN/7776521&RS=PN/7776521

Original video: https://odysee.com/@Corona-Ausschuss:3/Sitzung-60-Die-Zeit-ist-kein-flacher-Kreis-5-Martin:f?

#DavidEMartin #CoronaAusschuss #ReinerFuellmich #SARS-Cov-2 #plandemic #patents #scamdemic #Pfizer #Moderna #J&J

2 weeks, 6 days ago

Oracle Films, July 9, 2021

Professor Sucharit Bhakdi, M.D.

Some good news and some troubling news, from Professor Sucharit Bhakdi, M.D.

Please take the time to process this presentation. Dr. Bhakdi explains clearly, based on new scientific evidence, why he believes:

- Your immune system is your best defence against SARS-CoV-2, and indeed all coronaviruses.
- If you have been infected, even if you experienced no symptoms at all, you are immune to all variants.
- We have already reached herd immunity.
- There is no scientific reason to vaccinate against SARS-CoV-2. There is simply no benefit and the rollout must be stopped.

And much more.

⁣Scientific literature references for Dr. Bhakdi's presentation:
https://www.sciencedirect.com/science/article/pii/S2352396421002036 (v important DK)
https://journals.plos.org/plosone/article?id=10.1371%2Fjournal.pone.0249499 v. imp. IgG IgA
response to mRNA vacc. +++
https://academic.oup.com/cid/advance-article/doi/10.1093/cid/ciab465/6279075 (key spike and IgG after vacc)
https://www.cell.com/cell/fulltext/S0092-8674(21)00706-6 (third IgG response to vaccine paper)

3 weeks ago

Dr David E. Martin talks about:
- Lab leak red herring
- Daszak telling we need a global pandemic to get more funding....
- Baric desining a new virus with higher infectivity and lower transmissibility
- NIH/NIAD pan-universal influenza vaccine development that failed...
- .... which was then relabelled as Warp Speed (under Trump)
- ... which already contained programs for: DNA vaccines (AstraZeneca), mRNA vaccine (Pfizer-Biontec/Moderna), viral vector vaccines and self-assembling nanobot vaccines
- The Disappearing influenza started disappearing already before COVID and it's precautions...

Original video: https://www.youtube.com/watch?v=OnUqkokF0zU
Original air date: 21st of June 2021

3 weeks, 4 days ago

Discussion on the Study: ‘Virus’ Is Identical to Normal Cell ‘Structures’
In this live webinar, I discussed a paper that I received from one of my listeners that puts another nail in the coffin for the existence of SARS-CoV-2. I also do a Q&A session in the second half of the video at the:30:00 mark
Source: Dr. Tom Cowan

1 month, 2 weeks ago

Dr Sherri Tenpenny, is the American osteopathic medical doctor, researcher and author.

She has invested 20 years, and over 40,000 hours, researching, documenting and exposing the complex issues of vaccine development, testing and distribution.

As an internationally renowned speaker and author, her articles have been translated into over 12 languages.

Dr. Tenpenny has worked as an Emergency Medicine physician and were Director of a Level 2 Trauma centre for over a decade.

She now runs her own medical centre, providing an integrated approach to health, which has attracted patients from 50 states and 17 countries, with the doctrine “the body can heal itself”.

clip 4 of 15 - https://freedomplatform.tv/dr-sherri-tenpenny-face-masks-are-not-effective-against-covid-19-how-masks-are-being-used-to-control-the-population/

How to Engineer a Virus, Create a Test Kit and Vaccine for a Gold Rush (updates)
https://msb1959.wordpress.com/2021/05/19/how-to-engineer-a-virus-create-a-test-kit-and-vaccine-for-a-gold-rush/

1 month, 4 weeks ago

Dr Peter McCullough, MPH, FACP, FCCP, FAHA, FNKF, FNLA, FCRSA, internist and cardiologist also academic Professor of Medicine at Texas ANM College of Medicine on his experience treating COVID19 patients.
Here he discusses the lack of leadership over the outbreak and inability to 'frame the problems.

2 months ago

Dr Peter McCullough, MPH, FACP, FCCP, FAHA, FNKF, FNLA, FCRSA, internist and cardiologist also academic Professor of Medicine at Texas ANM College of Medicine on his experience treating COVID19 patients.
Here he explains what initial reports there were and the problems with academic publication schedules and how the system fell back on 'preprints' and what impact that had.

2 months ago

SARS-CoV-2 op zoek naar de waarheid

2 months, 2 weeks ago

In diesem Video prüfe ich das Wort Corona und hinterfrage, ob diese Welt Hollywood bzw. eine Bühne ist. Gibt es Dinge, die bemerkenswert sind beim Wort Corona?

3 months ago

"Habe Mut, dich deines eigenen Verstandes zu bedienen." ...und übernimm selbst Verantwortung.

In diesem Video möchten wir ihnen das Projekt Immanuel vorstellen, das sich kritisch mit den wissenschaftlichen Hintergründen der sogenannten "Corona-Krise" auseinandersetzt. Mit der Hilfe des erfahrenen Naturwissenschaftlers und Virologen Dr. Stefan Lanka werden in einer ganzen Reihe von Beiträgen alle grundlegenden Publikationen zu SARS-CoV-2 und COVID-19 genau unter die Lupe genommen und wissenschaftlich geprüft.
Dabei liegt unser Hauptaugenmerk darauf, die Wissenschaft allen Menschen verständlich zu machen. Alle nötigen Fachbegriffe und wissenschaftlichen Verfahren der Virologie und Mikrobiologie, die man kennen und verstehen muss, werden für jedermann leicht verständlich erklärt und mittels vieler Beispiele veranschaulicht.

Dies ist ein wissenschaftliches Projekt. Das bedeutet zum einen, auch wenn wir all das, was in der Corona-Krise getan wurde und geschehen ist, sehr kritisch hinterfragen, bleiben wir stets neutral. Weder ergreifen wir Partei für jemanden noch verurteilen wir irgendwen. Wir analysieren alles aus einer rein wissenschaftlich-medizinischen Sicht.
Zum anderen bedeutet es, dass wir Sie als Zuschauer ausdrücklich dazu auffordern, keine unserer Aussagen einfach zu glauben! Im Gegenteil, zweifeln Sie, seien Sie kritisch und hinterfragen Sie uns. Wer unsere Aussagen widerlegen kann, ist hiermit herzlich eingeladen, das zu tun, sollte jedoch mit handfesten, überprüfbaren Fakten argumentieren. Sollten wir wirklich Fehler gemacht haben, sind wir gerne bereit, diese zu korrigieren.

Hinter Projekt Immanuel steht eine kleine Gruppe unabhängiger Filmemacher, die mithelfen möchte, wissenschaftliche Fakten in die Öffentlichkeit zu tragen, die vom Großteil der Menschen nur deshalb ignoriert werden, weil sie nicht dem vorherrschenden Weltbild und dem anerkannten Konsens entsprechen.

Projekt Immanuel ist ein gemeinnütziges Projekt. Unsere Beiträge sollen frei zugänglich sein und sind für alle Menschen gedacht. Unter der Voraussetzung, dass an unseren Veröffentlichungen absolut NICHTS VERÄNDERT wird, darf jedes unserer Videos und Dokumente heruntergeladen, weitergegeben und auf eigenen Kanälen wieder hochgeladen werden. Bei unseren Videos muss zusätzlich die vollständige Videobeschreibung mit übernommen werden!

Auf welchen Portalen und in welchen Sprachen unsere Beiträge veröffentlicht werden, erfahren Sie auf unserer Webseite.

Wenn Sie uns kontaktieren möchten, nutzen Sie hierfür folgende Adresse:
[email protected]

Alle Infos zu neuen Beiträgen erhalten sie auf unserer Webseite oder in unserer Telegram-Gruppe.

Webseite: www.projekt-immanuel.de
Telegram: t.me/projekt_immanuel

UNSERE VIDEOKANÄLE:
Bitchute: www.bitchute.com/projekt-immanuel
Dailymotion: https://www.dailymotion.com/dm_098181bca1aded04ba222830d0d2da6e
Odysee: https://odysee.com/@Projekt-Immanuel:3

QUELLEN:
(1) "A new coronavirus associated with human respiratory disease in China”
PUBLIKATION: "Ein neues Coronavirus im Zusammenhang mit menschlichen Atemwegserkrankungen in China" [Englisch]
AUTOREN: Fan Wu, Su Zhao, Bin Yu, Yan-Mei Chen et al.
MAGAZIN: "Nature" - AUSGABE: Band 579, (online Veröffentlichung am 03. Februar 2020) 12. März 2020 (S. 265-269)
QUELLE: https://doi.org/10.1038/s41586-020-2008-3
FUNDORT: https://www.nature.com/articles/s41586-020-2008-3

(2) "A Novel Coronavirus from Patients with Pneumonia in China, 2019"
PUBLIKATION: "Ein neuartiges Coronavirus von Patienten mit Lungenentzündung in China, 2019" [Englisch]
AUTOREN: Na Zhu, Ph.D., Dingyu Zhang, M.D., Wenling Wang, Ph.D., Xingwang Li, M.D. et al.
MAGAZIN: "New England Journal of Medicine" - AUSGABE: Nr. 8, Band 382, 24. Janaur 2020 [aktualisiert am 29. Januar 2020] (S. 727-733)
QUELLE: "N Engl J Med 2020;382:727-33. DOI: 10.1056/NEJMoa2001017"
FUNDORT: https://www.nejm.org/doi/full/10.1056/NEJMoa2001017

(3) "Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR"
PUBLIKATION: "Nachweis des neuartigen Coronavirus von 2019 (2019-nCoV) mittels Echtzeit-RT-PCR" [Englisch]
AUTOREN: Christian Drosten, Olfert Landt et al.
MAGAZIN: "Eurosurveillance" - AUSGABE: Nr. 3, Band 25, 23. januar 2020 (S. 727-733)
QUELLE: "Euro Surveill. 2020;25(3):pii=2000045.
https://doi.org/10.2807/1560-7917.ES.2020.25.3.2000045"
FUNDORT: https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.3.2000045

Quelle
https://www.bitchute.com/video/R2YKnmjgPGXq/
https://www.bitchute.com/channel/I0cl0F5WBwZc/

3 months ago

Tracks just a few of the seriously problematic issues with the COVID-19 narrative as told by governments and major media outlets up to the early Spring of 2021. The result of this narrative has been to terrorize the public into compliance causing them to willingly line-up to receive experimental gene therapies whose long-term side-effects could be lethal at worst or debilitating at best.

For further discussion on the long-term side-effects listen to Dr. Sucharit Bhakdi, retired Chair of the Department of Medical Microbiology at the University of Mainz in Germany:
https://www.youtube.com/watch?v=pyPjAfNNA-U

To learn about the man-made origins of SARS-COV-2 as evidenced by the history of the Gain of Function research on coronaviruses via patents and funding grants view this presentation by Dr. Richard Fleming, (PhD, MD, JD). He also addresses the potential long-term effects of the experimental vaccines:
https://rumble.com/veom9x-sars-cov-2-and-covid-19..html

UPDATE JUNE 2021
A cash of emails to and from Fauci was recently released under FOIA which reveal his ties with Gain of Function research at the Wuhan Lab, which he previously denied under oath. See: https://www.youtube.com/watch?v=yp6btJhS66c

3 months, 1 week ago

Richard M. Fleming (of https://www.flemingmethod.com/ ) gives his full presentation on the origin, gain-of-function, spread, function, symptoms, (COVID-19) disease damages, treatments, data trickery of the pandemic and vaccines (against) SARS-CoV-2.

Interview by Miles Johnston (The Bases Project).

Original unlisted file at youtube:
https://www.youtube.com/watch?v=ZJ0MYmKY8_U&t=1928s

The actual presentation starts at c. 21 minutes.

3 months, 1 week ago

Two distinguished and noteworthy professors in the fields of immunological sciences, epidemiology and molecular biology, Prof Dolores Cahill interviewed by Martin Byrne of Oracle Films and Dr Sucharit Bhakdi interviewed by Alex Newman of The New American.

Decide for yourselves on the so called risks and the lies we've been spoon fed by the mainstream media.

Courtesy of Oracle Films and The New American.

- more -

https://www.bitchute.com/video/dwyXJC9VBcUb/

3 months, 1 week ago

This is 10000x over worth watching - share
If we all do this, they will have no choice but to admit it or do away with it. Give this video one minute and let me explain!

FREE (of course ) Email template at:
https://www.vtvault.org/foia

Let’s destroy this shit and expose them with this powerful tool!

3 months, 2 weeks ago

April 2021 - The horseshoe bat – currently identified as the genetic source of SARS-CoV-2 – lives in Southern China.
Wuhan is situated north-east of the center, which is well beyond their range.

Wuhan has China’s only level-four virology institute with the world’s largest collection of bat coronaviruses.

“The core point is that any examination of the origins of the pandemic needs to thoroughly examine ALL of the possible origin hypotheses,” Mr Metzl said. “It cannot be credible to say we’re only going to look at a zoonotic jump and cold chain, and we won’t lift a finger to examine the lab leak hypothesis.

----- Personal note: "If there was an Ebola outbreak close to an Ebola laboratory, would it be crazy to assume that this lab could be the source of that outbreak?"

3 months, 3 weeks ago

Este es el video original:
https://brandnewtube.com/watch/canadian-doctors-speak-out_mTo3VVoCp7spABS.html

La Alianza por la Salud de Canadá muestra a varios doctores exponiendo hechos científicos comprobados sobre el COVID-19 y las principales razones para no temer al COVID-19.

"La información médica basada en evidencia debe ser el factor determinante en todas las reglas, políticas y procedimientos gubernamentales de atención médica. Además, el primer principio de la práctica médica y de atención médica es no causar daño".

Los derechos de copia y autoría del video corresponden a sus respectivos dueños, la intención de mostrarlo es sólo con propósitos educacionales y de divulgación científica para auditorios hispanoparlantes.

Original video here:
https://brandnewtube.com/watch/canadian-doctors-speak-out_mTo3VVoCp7spABS.html

The Canada Health Alliance features multiple doctors laying out proven scientific facts about COVID-19 and the top reasons not to fear COVID-19.

The copyrights of and authorship of the video correspond to their respective owners, the primary intention of showing it here it's only for educational purposes and scientific dissemination for Spanish-speaking auditoriums.

4 months ago

"Habe Mut, dich deines eigenen Verstandes zu bedienen." ...und übernimm selbst Verantwortung.

In diesem Video möchten wir ihnen das Projekt Immanuel vorstellen, das sich kritisch mit den wissenschaftlichen Hintergründen der sogenannten "Corona-Krise" auseinandersetzt. Mit der Hilfe des erfahrenen Naturwissenschaftlers und Virologen Dr. Stefan Lanka werden in einer ganzen Reihe von Beiträgen alle grundlegenden Publikationen zu SARS-CoV-2 und COVID-19 genau unter die Lupe genommen und wissenschaftlich geprüft.
Dabei liegt unser Hauptaugenmerk darauf, die Wissenschaft allen Menschen verständlich zu machen. Alle nötigen Fachbegriffe und wissenschaftlichen Verfahren der Virologie und Mikrobiologie, die man kennen und verstehen muss, werden für jedermann leicht verständlich erklärt und mittels vieler Beispiele veranschaulicht.

Dies ist ein wissenschaftliches Projekt. Das bedeutet zum einen, auch wenn wir all das, was in der Corona-Krise getan wurde und geschehen ist, sehr kritisch hinterfragen, bleiben wir stets neutral. Weder ergreifen wir Partei für jemanden noch verurteilen wir irgendwen. Wir analysieren alles aus einer rein wissenschaftlich-medizinischen Sicht.
Zum anderen bedeutet es, dass wir Sie als Zuschauer ausdrücklich dazu auffordern, keine unserer Aussagen einfach zu glauben! Im Gegenteil, zweifeln Sie, seien Sie kritisch und hinterfragen Sie uns. Wer unsere Aussagen widerlegen kann, ist hiermit herzlich eingeladen, das zu tun, sollte jedoch mit handfesten, überprüfbaren Fakten argumentieren. Sollten wir wirklich Fehler gemacht haben, sind wir gerne bereit, diese zu korrigieren.

Hinter Projekt Immanuel steht eine kleine Gruppe unabhängiger Filmemacher, die mithelfen möchte, wissenschaftliche Fakten in die Öffentlichkeit zu tragen, die vom Großteil der Menschen nur deshalb ignoriert werden, weil sie nicht dem vorherrschenden Weltbild und dem anerkannten Konsens entsprechen.

Projekt Immanuel ist ein gemeinnütziges Projekt. Unsere Beiträge sollen frei zugänglich sein und sind für alle Menschen gedacht. Unter der Voraussetzung, dass an unseren Veröffentlichungen absolut NICHTS VERÄNDERT wird, darf jedes unserer Videos und Dokumente heruntergeladen, weitergegeben und auf eigenen Kanälen wieder hochgeladen werden. Bei unseren Videos muss zusätzlich die vollständige Videobeschreibung mit übernommen werden!

Auf welchen Portalen und in welchen Sprachen unsere Beiträge veröffentlicht werden, erfahren Sie auf unserer Webseite.

Wenn Sie uns kontaktieren möchten, nutzen Sie hierfür folgende Adresse:
[email protected]

Alle Infos zu neuen Beiträgen erhalten sie auf unserer Webseite oder in unserer Telegram-Gruppe.

Webseite: www.projekt-immanuel.de
Telegram: t.me/projekt_immanuel

UNSERE VIDEOKANÄLE:
Bitchute: www.bitchute.com/projekt-immanuel
Dailymotion: https://www.dailymotion.com/dm_098181bca1aded04ba222830d0d2da6e
Odysee: https://odysee.com/@Projekt-Immanuel:3

QUELLEN:
(1) "A new coronavirus associated with human respiratory disease in China”
PUBLIKATION: "Ein neues Coronavirus im Zusammenhang mit menschlichen Atemwegserkrankungen in China" [Englisch]
AUTOREN: Fan Wu, Su Zhao, Bin Yu, Yan-Mei Chen et al.
MAGAZIN: "Nature" - AUSGABE: Band 579, (online Veröffentlichung am 03. Februar 2020) 12. März 2020 (S. 265-269)
QUELLE: https://doi.org/10.1038/s41586-020-2008-3
FUNDORT: https://www.nature.com/articles/s41586-020-2008-3

(2) "A Novel Coronavirus from Patients with Pneumonia in China, 2019"
PUBLIKATION: "Ein neuartiges Coronavirus von Patienten mit Lungenentzündung in China, 2019" [Englisch]
AUTOREN: Na Zhu, Ph.D., Dingyu Zhang, M.D., Wenling Wang, Ph.D., Xingwang Li, M.D. et al.
MAGAZIN: "New England Journal of Medicine" - AUSGABE: Nr. 8, Band 382, 24. Janaur 2020 [aktualisiert am 29. Januar 2020] (S. 727-733)
QUELLE: "N Engl J Med 2020;382:727-33. DOI: 10.1056/NEJMoa2001017"
FUNDORT: https://www.nejm.org/doi/full/10.1056/NEJMoa2001017

(3) "Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR"
PUBLIKATION: "Nachweis des neuartigen Coronavirus von 2019 (2019-nCoV) mittels Echtzeit-RT-PCR" [Englisch]
AUTOREN: Christian Drosten, Olfert Landt et al.
MAGAZIN: "Eurosurveillance" - AUSGABE: Nr. 3, Band 25, 23. januar 2020 (S. 727-733)
QUELLE: "Euro Surveill. 2020;25(3):pii=2000045.
https://doi.org/10.2807/1560-7917.ES.2020.25.3.2000045"
FUNDORT: https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.3.2000045

4 months ago

Dr. Sherri Tenpenny exposes in this interview by Alex Jones all the health complications that will cause the experimental emergency "vaccines", and offers us a series of 10 injuries that can cause after the application of the injection and its sequelae during the following years.

The copyrights of and authorship of the video correspond to their respective owners, the primary intention of showing it here it's only for educational purposes and scientific dissemination for Spanish-speaking auditoriums.
_________
La Dra. Sherri Tenpenny expone en esta entrevista por Alex Jones todas las complicaciones de salud que provocarán las "vacunas" experimentales de emergencia, y nos ofrece una serie de 10 lesiones que puede provocar después de la aplicación de la inyección y sus secuelas durante los siguientes años.

Los derechos de copia y autoría del video corresponden a sus respectivos dueños, la intención de mostrarlo es sólo con propósitos educacionales y de divulgación científica para auditorios hispanoparlantes.

4 months, 1 week ago

The Corbett Report (06.03.2021)

"Auf den ersten Blick mag die Bioethik wie ein weiterer Zweig der ethischen Philosophie erscheinen, in dem Akademiker endlos mit anderen Akademikern darüber debattieren, wie viele Engel auf einem Stecknadelkopf in weit entfernten, Science-Fiction-artigen Szenarien tanzen. Was viele jedoch nicht wissen, ist, dass das scheinbar harmlose akademische Studium der Bioethik seine Wurzeln in der dunklen Geschichte der Eugenik hat. Mit diesem Wissen werden die Gefahren, die damit verbunden sind, einige der wichtigsten Diskussionen über Leben, Tod und Gesundheit der Menschheit in die Hände einiger weniger anzuvertrauen, noch offensichtlicher."

Deutsche Übersetzung durch das "Video Translate Projects Team"
#V015, #VideoTranslateProjects, https://t.me/VideoTranslateProjects

Voice Over: Jürgen, Karina, Tee Ma, Ignatia Intolerantia
Übersetzung: Ignatia Intolerantia

4 months, 1 week ago

AUCH ATTACKEN MIT NEGATIVBEWERTUNGEN KÖNNEN DIE WAHRHEIT NICHT AUFHALTEN
============================================================================
DEUTSCH / GERMAN
CORONA-AUSSCHUSS / Dr. Wolfgang Wodarg
-----------------------------------------------------------------------
Tägliche politische und Geoengineering-Nachrichten:
https://vk.com/chembuster
Meine Kanäle:
https://www.bitchute.com/channel/chembuster/
https://vimeo.com/chembuster

Mein Gruß an alle Partioten in der Welt:
https://www.bitchute.com/video/WDD2ipFE70ix/

4 months, 2 weeks ago

AUCH ATTACKEN MIT NEGATIVBEWERTUNGEN KÖNNEN DIE WAHRHEIT NICHT AUFHALTEN
============================================================================
DEUTSCH / GERMAN
ANTIILLUMINATEN.TV
https://t.me/antiilluminaten
Übersetzter Artikel dazu:
👉 KLICK (https://telegra.ph/Dr-Andrew-Kaufman-Dr-Tom-Cowan-Und-Sally-Fallon-Morell-SARS-CoV-2-Ist-Noch-Nicht-Nachgewiesen-Worden-03-03)
Original Artikel:
👉 KLICK (https://humansarefree.com/2021/03/sars-cov-2-was-never-isolated-and-proven-to-exist.html)
Antiilluminaten TV ( ☕️ Kaffeekasse)
👉 KLICK (https://www.paypal.com/paypalme/alex081)
Mehr kostenfreie Infos und Enthüllungen:
👉 https://t.me/antiilluminaten
------------------------------------------------------------------------------------------
Tägliche politische und Geoengineering-Nachrichten:
https://vk.com/chembuster
Meine Kanäle:
https://www.bitchute.com/channel/chembuster/
https://vimeo.com/chembuster

Mein Gruß an alle Partioten in der Welt:
https://www.bitchute.com/video/WDD2ipFE70ix/

4 months, 3 weeks ago

This is a FAKE "Virus" that has NEVER been Isolated ANYWHERE in Reality, folks!!! NEVER. EVER. Watch my video on just that here, "10 Reasons that SARS-CoV-2 Is an Imaginary Theoretical 'Virus' - https://www.bitchute.com/video/vUAnsi8hHpWj/

I mirrored this video from 'truthhunter' here - https://www.bitchute.com/video/W9BxyMzfFgK5/

Please also watch this video: https://www.bitchute.com/video/igJsj6lrKUX1/ to understand the background information behind all this surreal shit they're doing with mRNA technology & the sordid shit they've done to our health via the environment et al. We must wake up our world & RE-OPEN THE WORLD. There is NO VIRUS called Covid-19 to speak of! They're destroying our planet INTENTIONALLY, so we must only remove those BAD APPLES and we'd have a peaceful place to exist!

I am so sick of human beings blindly following these murderous creatures!!! 😡

The ONLY people dying from 'Covid-19' are those dying from the mRNA #DepopShots - no joke. This is DEADLY serious, folks. How about the Polish Doctor who MADE FUN OF THOSE WHO US WHO QUESTION THESE SORDID INJECTIONS only to DIE 3 days later from heart complications... watch the video I made on this here - https://www.bitchute.com/video/eNm5BbaoUQG6/

We have no earthly clue the long-term consequences and ramifications of these mRNA injections. This is POISONOUS to our human bodies. We should not be injecting this shit into ourselves. We are modifying our genetic make-up only to be patented by some fuckin corporation who uses you like a lab-rat...

Please DO NOT take the mRNA injection. They have on LIABILITY for it. If this KILLS you or HARMS you for the rest of your life you have ZERO RECOURSE! No one will help you!!! Imagine that! These are homicidal criminal syndicates running the U.S. Government today.

Watch some other pertinent videos I created on this very subject:

This Bolshevik Corona PsyOp Has Turned Hospitals Into Talmudic Slaughter Houses - https://www.bitchute.com/video/b3I0ngmGRdQw/

COVID-19 Does *NOT EXIST* according to the CDC & FDA! (( PROOF )) - https://www.bitchute.com/video/iLVk3D0V9HHt/

GovDid19 - The Great 2020 Covid-Hoax Lockdown Explained - https://www.bitchute.com/video/wXHi4KM2xe3n/

They're Genetically Modifying eWe! (( Coronavirus, mRNA & Transhumanism )) - https://www.bitchute.com/video/5da96IeQ9UoB/

Moderna Admits These mRNA Vaccines Are Actually Operating Systems (( *NOT* MEDICINE )) - https://www.bitchute.com/video/SolbGRkCprxN/

Follow the Fuckin Shekels! - https://www.bitchute.com/video/Z4d6cVqLgKGz/

Proof this Corona-Hoax was being Promulgated in 2018! - https://www.bitchute.com/video/v6Phy1fdZuyJ/

The Masked Ritual of Global Enslavement Explained - https://www.bitchute.com/video/Q5Mz6WuZuKs9/

Jewish Doctor & Vaccine Advocate Dies after taking the Pfizer Shot - https://www.bitchute.com/video/dFzScJSZ1nYE/

'They've Killed God. I Can't Feel God. My Soul is Dead.' (( COVID-19 Vaxx )) - https://www.bitchute.com/video/YN4PCMuOTKn7/

How to CREATE a PANDEMIC: There's Nothing New Under the Sun - https://www.bitchute.com/video/0ksAAyWQX9Uj/

4 Reasons to NEVER take an mRNA Vaccine (( this is NOT medicine! )) - https://www.bitchute.com/video/42pnp5YZtnTO/

Why are ((( they ))) Racing to Inject us with their CV19 Vaccine? - https://www.bitchute.com/video/lOL4zMpyaJ6K/

“This is the Biggest Hoax ever perpetrated on an Unsuspecting Public” -Dr. Roger Hodkinson - https://www.bitchute.com/video/7y9Trikhb1nD/

How SAFE are Vaccines? - https://www.bitchute.com/video/QHwpwyiui2Qt/

The 2020 Coronavirus PsyOp - They Planned This Over 50 Years Ago - https://www.bitchute.com/video/uryR3hmzUENr/

50 MILLION AMERICANS WILL DIE FROM THE COVID-19 VACCINE - https://www.bitchute.com/video/JyF1K78G3J2T/

"I know thy works, and tribulation, and poverty, (but thou art rich) and I know the blasphemy of them which say they are Jews, and are not, but are the synagogue of Satan. ✡️" -Revelation 2:9

"Behold, I will make them of the synagogue of Satan ✡️, which say they are Jews, and are not, but do lie; behold, I will make them to come and worship before thy feet, and to know that I have loved thee." -Revelation 3:9

☣️ https://fuckthejews.com/ ☢️

Beware of the devil offering free gifts...

"Wherein the King granted the Jews which were in every city to gather themselves together, and to stand for their life, to destroy, to slay, and to cause to perish, all the power of the people and province that would assault them, both little ones and women, and to take the spoil of them for their prey." -Esther 8:11

"Study to show thyself approved unto God." -2 Timothy 2:15

Contact me here - [email protected]

Peace&Love
God bless
Chris Switzer

4 months, 3 weeks ago

Американский врач Томас Коуэн (Dr. Thomas Cowan) объясняет, что причинно-следственная связь между возбудителем и болезнью устанавливается стандартной лабораторной процедурой состоящей из нескольких обязательных этапов. Но всё дело в том, что никто и никогда не проводил этой процедуры не только для установления причины заболевания COVID-19 но и для таких заболеваний как СПИД, Гепатит С, Корь и других.

Ссылка на оригинал видео на английском: https://brandnewtube.com/v/WxqenF
Дополнительно:
Доктор Томас Коуэн указывает на фальсификацию CDC вируса COVID-19: https://aizen-tt.livejournal.com/2316615.html

4 months, 3 weeks ago

Mirrored from Truthhunter here on Bitch ute
https://www.bitchute.com/video/W9BxyMzfFgK5/
#TakeBackBritain

4 months, 3 weeks ago

Article, by author Makia Freeman - https://thefreedomarticles.com/10-reasons-sars-cov-2-imaginary-digital-theoretical-virus/
1st Video (Dr. Andrew Kaufman) from article - https://www.bitchute.com/video/eOGvhrGTVq6N/
2nd Video (Dr. Wu Zunyou, Chinese CDC) from article - https://twitter.com/EEccetera/status/1354208913315528705

SARS-CoV-2 ("Covid-19") is NOT Real. It's a theoretical 'virus', as proven in the article/video. Please leave your comments below & watch the other videos on the subject below:

Please also watch this video: https://www.bitchute.com/video/igJsj6lrKUX1/ to understand the background information behind all this surreal shit they're doing with mRNA technology & the sordid shit they've done to our health via the environment et al. We must wake up our world & RE-OPEN THE WORLD. There is NO VIRUS called Covid-19 to speak of! They're destroying our planet INTENTIONALLY, so we must only remove those BAD APPLES and we'd have a peaceful place to exist!

I am so sick of human beings blindly following these murderous creatures!!! 😡

The ONLY people dying from 'Covid-19' are those dying from the mRNA #DepopShots - no joke. This is DEADLY serious, folks. How about the Polish Doctor who MADE FUN OF THOSE WHO US WHO QUESTION THESE SORDID INJECTIONS only to DIE 3 days later from heart complications... watch the video I made on this here - https://www.bitchute.com/video/eNm5BbaoUQG6/

We have no earthly clue the long-term consequences and ramifications of these mRNA injections. This is POISONOUS to our human bodies. We should not be injecting this shit into ourselves. We are modifying our genetic make-up only to be patented by some fuckin corporation who uses you like a lab-rat...

Please DO NOT take the mRNA injection. They have on LIABILITY for it. If this KILLS you or HARMS you for the rest of your life you have ZERO RECOURSE! No one will help you!!! Imagine that! These are homicidal criminal syndicates running the U.S. Government today.

Watch some other pertinent videos I created on this very subject:

This Bolshevik Corona PsyOp Has Turned Hospitals Into Talmudic Slaughter Houses - https://www.bitchute.com/video/b3I0ngmGRdQw/

COVID-19 Does *NOT EXIST* according to the CDC & FDA! (( PROOF )) - https://www.bitchute.com/video/iLVk3D0V9HHt/

GovDid19 - The Great 2020 Covid-Hoax Lockdown Explained - https://www.bitchute.com/video/wXHi4KM2xe3n/

They're Genetically Modifying eWe! (( Coronavirus, mRNA & Transhumanism )) - https://www.bitchute.com/video/5da96IeQ9UoB/

Moderna Admits These mRNA Vaccines Are Actually Operating Systems (( *NOT* MEDICINE )) - https://www.bitchute.com/video/SolbGRkCprxN/

Follow the Fuckin Shekels! - https://www.bitchute.com/video/Z4d6cVqLgKGz/

Proof this Corona-Hoax was being Promulgated in 2018! - https://www.bitchute.com/video/v6Phy1fdZuyJ/

The Masked Ritual of Global Enslavement Explained - https://www.bitchute.com/video/Q5Mz6WuZuKs9/

Jewish Doctor & Vaccine Advocate Dies after taking the Pfizer Shot - https://www.bitchute.com/video/dFzScJSZ1nYE/

'They've Killed God. I Can't Feel God. My Soul is Dead.' (( COVID-19 Vaxx )) - https://www.bitchute.com/video/YN4PCMuOTKn7/

How to CREATE a PANDEMIC: There's Nothing New Under the Sun - https://www.bitchute.com/video/0ksAAyWQX9Uj/

4 Reasons to NEVER take an mRNA Vaccine (( this is NOT medicine! )) - https://www.bitchute.com/video/42pnp5YZtnTO/

Why are ((( they ))) Racing to Inject us with their CV19 Vaccine? - https://www.bitchute.com/video/lOL4zMpyaJ6K/

“This is the Biggest Hoax ever perpetrated on an Unsuspecting Public” -Dr. Roger Hodkinson - https://www.bitchute.com/video/7y9Trikhb1nD/

How SAFE are Vaccines? - https://www.bitchute.com/video/QHwpwyiui2Qt/

The 2020 Coronavirus PsyOp - They Planned This Over 50 Years Ago - https://www.bitchute.com/video/uryR3hmzUENr/

50 MILLION AMERICANS WILL DIE FROM THE COVID-19 VACCINE - https://www.bitchute.com/video/JyF1K78G3J2T/

"I know thy works, and tribulation, and poverty, (but thou art rich) and I know the blasphemy of them which say they are Jews, and are not, but are the synagogue of Satan. ✡️" -Revelation 2:9

"Behold, I will make them of the synagogue of Satan ✡️, which say they are Jews, and are not, but do lie; behold, I will make them to come and worship before thy feet, and to know that I have loved thee." -Revelation 3:9

☣️ https://fuckthejews.com/ ☢️

Beware of the devil offering free gifts...

"Wherein the King granted the Jews which were in every city to gather themselves together, and to stand for their life, to destroy, to slay, and to cause to perish, all the power of the people and province that would assault them, both little ones and women, and to take the spoil of them for their prey." -Esther 8:11

"Study to show thyself approved unto God." -2 Timothy 2:15

Contact me here - [email protected]

4 months, 3 weeks ago

In this video we would like to introduce Project Immanuel, which critically examines the scientific background of the so-called "Corona Crisis." With the help of the natural scientist and virologist Dr. Stefan Lanka, all fundamental publications on SARS-CoV-2 and COVID-19 are closely scrutinised and scientifically examined in a series of posts.
Our main objective is to make science understandable to everyone. All the necessary technical terms and scientific procedures of virology and microbiology that one needs to know and understand are explained in a way that is easy for everyone to comprehend and illustrated with many examples.

This is a scientific project. This means, for one thing, that although we are very critical of all that has been done and has happened in the Corona crisis, we always remain neutral. We do not take sides with anyone, nor do we condemn anyone. We analyse everything from a purely scientific medical point of view.
It also means that we emphatically ask you, the viewer, not to simply believe any of our statements! On the contrary, doubt, be critical and question us. Anyone who can refute our statements is hereby cordially invited to do so, but should do so with tangible, verifiable facts. If we have really made mistakes, we are happy to correct them.

Behind Project Immanuel is a small group of independent filmmakers who want to help bring into the public domain scientific facts that are ignored by the majority of people only because they do not conform to the predominant worldview and accepted consensus.

- - -

Project Immanuel is a non-profit project. Our contributions shall be freely accessible and are intended for all people. Provided that absolutely NOTHING is changed in our publications, any of our videos and documents may be downloaded, shared and re-uploaded on your own channels. For our videos, the complete video description must also be included!
You can find out on which platforms and in which languages our reports are published by visiting our website.

- - -

If you would like to contact us, please use the following address: [email protected]

All information about new posts can be found on our website and in our Telegram group.
Website: www.projekt-immanuel.de
Telegram: t.me/projekt_immanuel

OUR VIDEO CHANNELS:
Bitchute: www.bitchute.com/projekt-immanuel
Dailymotion: https://www.dailymotion.com/dm_098181bca1aded04ba222830d0d2da6e
Odysee: https://odysee.com/@Projekt-Immanuel:3

- - -

LIST OF REFERENCES:

1) "A new coronavirus associated with human respiratory disease in China”
PUBLICATION: "A new coronavirus associated with human respiratory disease in China" [English]
AUTHORS: Fan Wu, Su Zhao, Bin Yu, Yan-Mei Chen et al.
MAGAZINE: "Nature" - ISSUE: Vol. 579, (published online February 03, 2020) March 12, 2020 (S. 265-269)
SOURCE: "https://doi.org/10.1038/s41586-020-2008-3"
LOCATION: https://www.nature.com/articles/s41586-020-2008-3

(2) "A Novel Coronavirus from Patients with Pneumonia in China, 2019"
PUBLICATION: "A Novel Coronavirus from Patients with Pneumonia in China, 2019" [English]
AUTHORS: Na Zhu, Ph.D., Dingyu Zhang, M.D., Wenling Wang, Ph.D., Xingwang Li, M.D. et al.
MAGAZINE: "New England Journal of Medicine" - ISSUE: No. 8, Vol. 382, Jan. 24, 2020 [updated Jan. 29, 2020] (pp. 727-733)
SOURCE: "N Engl J Med 2020;382:727-33. DOI: 10.1056/NEJMoa2001017"
LOCATION: https://www.nejm.org/doi/full/10.1056/NEJMoa2001017

(3) "Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR"
PUBLICATION: "Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR" [English]
AUTHORS: Christian Drosten, Olfert Landt et al.
MAGAZINE: "Eurosurveillance" - ISSUE: No. 3, Vol. 25, January 23, 2020 (pp. 727-733)
SOURCE: "Euro Surveill. 2020;25(3):pii=2000045. https://doi.org/10.2807/1560-7917.ES.2020.25.3.2000045"
LOCATION: https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.3.2000045
Source: Projekt-Immanuel

5 months, 1 week ago

Un pequeño aporte a nuestro querido YoM, acabo de abrir este canal y espero que difundan lo más posible este video para que el trabajo de nuestro estimado se haga relevante en estos espacios.
Canal de YT de YoM: https://www.youtube.com/user/MrYoM5
Su twitter: https://twitter.com/YoM_5
Mi canal de YT: https://www.youtube.com/channel/UCKf1xqWJ8sgK8A4MrXuHP-w
Mi twitter: https://twitter.com/QuestionerMax

5 months, 1 week ago

Willem Engel with Stephen Quay, February 17, 2021

The Virus is lab-made

Dr. Stephen Quay about the Bayesian Analysis of SARS-CoV-2

https://www.facebook.com/113266477112887/videos/257639745806905/

https://viruswaarheid.nl/

5 months, 1 week ago

Un pequeño aporte a nuestro querido YoM, acabo de abrir este canal y espero que difundan lo más posible este video para que el trabajo de nuestro estimado se haga relevante en estos espacios.
Canal de YT de YoM: https://www.youtube.com/user/MrYoM5
Su twitter: https://twitter.com/YoM_5
Mi canal de YT: https://www.youtube.com/channel/UCKf1xqWJ8sgK8A4MrXuHP-w

5 months, 1 week ago

In this video we would like to introduce Project Immanuel, which critically examines the scientific background of the so-called "Corona Crisis." With the help of the natural scientist and virologist Dr. Stefan Lanka, all fundamental publications on SARS-CoV-2 and COVID-19 are closely scrutinised and scientifically examined in a series of posts.
Our main objective is to make science understandable to everyone. All the necessary technical terms and scientific procedures of virology and microbiology that one needs to know and understand are explained in a way that is easy for everyone to comprehend and illustrated with many examples.

This is a scientific project. This means, for one thing, that although we are very critical of all that has been done and has happened in the Corona crisis, we always remain neutral. We do not take sides with anyone, nor do we condemn anyone. We analyse everything from a purely scientific medical point of view.
It also means that we emphatically ask you, the viewer, not to simply believe any of our statements! On the contrary, doubt, be critical and question us. Anyone who can refute our statements is hereby cordially invited to do so, but should do so with tangible, verifiable facts. If we have really made mistakes, we are happy to correct them.

Behind Project Immanuel is a small group of independent filmmakers who want to help bring into the public domain scientific facts that are ignored by the majority of people only because they do not conform to the predominant worldview and accepted consensus.

- - -

Project Immanuel is a non-profit project. Our contributions shall be freely accessible and are intended for all people. Provided that absolutely NOTHING is changed in our publications, any of our videos and documents may be downloaded, shared and re-uploaded on your own channels. For our videos, the complete video description must also be included!
You can find out on which platforms and in which languages our reports are published by visiting our website.

- - -

If you would like to contact us, please use the following address: [email protected]

All information about new posts can be found on our website and in our Telegram group.
Website: www.projekt-immanuel.de
Telegram: t.me/projekt_immanuel

OUR VIDEO CHANNELS:
Bitchute: www.bitchute.com/projekt-immanuel
Dailymotion: https://www.dailymotion.com/dm_098181bca1aded04ba222830d0d2da6e
Odysee: https://odysee.com/@Projekt-Immanuel:3

- - -

LIST OF REFERENCES:

1) "A new coronavirus associated with human respiratory disease in China”
PUBLICATION: "A new coronavirus associated with human respiratory disease in China" [English]
AUTHORS: Fan Wu, Su Zhao, Bin Yu, Yan-Mei Chen et al.
MAGAZINE: "Nature" - ISSUE: Vol. 579, (published online February 03, 2020) March 12, 2020 (S. 265-269)
SOURCE: "https://doi.org/10.1038/s41586-020-2008-3"
LOCATION: https://www.nature.com/articles/s41586-020-2008-3

(2) "A Novel Coronavirus from Patients with Pneumonia in China, 2019"
PUBLICATION: "A Novel Coronavirus from Patients with Pneumonia in China, 2019" [English]
AUTHORS: Na Zhu, Ph.D., Dingyu Zhang, M.D., Wenling Wang, Ph.D., Xingwang Li, M.D. et al.
MAGAZINE: "New England Journal of Medicine" - ISSUE: No. 8, Vol. 382, Jan. 24, 2020 [updated Jan. 29, 2020] (pp. 727-733)
SOURCE: "N Engl J Med 2020;382:727-33. DOI: 10.1056/NEJMoa2001017"
LOCATION: https://www.nejm.org/doi/full/10.1056/NEJMoa2001017

(3) "Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR"
PUBLICATION: "Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR" [English]
AUTHORS: Christian Drosten, Olfert Landt et al.
MAGAZINE: "Eurosurveillance" - ISSUE: No. 3, Vol. 25, January 23, 2020 (pp. 727-733)
SOURCE: "Euro Surveill. 2020;25(3):pii=2000045. https://doi.org/10.2807/1560-7917.ES.2020.25.3.2000045"
LOCATION: https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.3.2000045

5 months, 2 weeks ago

Wuhan scientist, Dr Wu Zinyou from the Chinese Centers for Disease Control (CDC) says:
"They didn't isolate the virus. That's the issue."
This gives added support to claims made by Principia Scientific International reporting on December 11, 2020: "COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a disease called COVID 19." https://principia-scientific.com/covid19-evidence-of-global-fraud/

5 months, 3 weeks ago

Dr. Wu Zunyou vom Chinese Center for Disease Control (CCDC) admits: We didn't isolate the virus. That's the problem... This eliminates any claim of evidence of SARS-CoV-2.
**************************************

FOLLOW me on Telegram: https://t.me/s/facts_vs_lies
REGISTER: http://bit.ly/ArturosBitchute
SUBSCRIBE: https://tinyurl.com/ArturosBitchute
SUBSCRIBE: https://lbry.tv/@bambaferko
REGISTER: https://tinyurl.com/BambaFerko
SUBSCRIBE: https://tinyurl.com/ArturosYoutube

PLAYLIST: http://tinyurl.com/y6ymsmx2 - (alternative) REALITY
PLAYLIST: https://tinyurl.com/sjqzvx4 - (alternative) MEDICINE
PLAYLIST: https://tinyurl.com/s7umr84 - Corona
PLAYLIST: https://tinyurl.com/yc5pm8ur - Gott & Satan
PLAYLIST: https://tinyurl.com/y5avtxkq - Geo-Engineering (Chemtrails)
PLAYLIST: http://tinyurl.com/y9y8naom - Fun & Entertainment

#covid #SARS-CoV-2 #SCAMdemic

5 months, 4 weeks ago

Molecular Virologist Judy Mikovits, PhD get interviewed by Dr. Joseph Mercola on the SARS-COV-2 "vaccines."
Full transcript of interview can be obtained from Dr. Mercola's website at:
https://articles.mercola.com/sites/articles/archive/2021/01/31/covid-19-vaccine-gene-therapy.aspx

The COVID-19 vaccine CANNOT be called a vaccine by a medical definition of a vaccine. It can be more accurately described as an "𝙚𝙭𝙥𝙚𝙧𝙞𝙢𝙚𝙣𝙩𝙖𝙡" gene therapy that could possibly prematurely kill large amounts of the population and disable exponentially more.

It is being called a vaccine mainly for two reasons which are:
• No-Liability Compensation for Vaccine Injury
• The majority of the population around the world are familiar with vaccines & assume they're safe

Since mRNA normally rapidly degrades, it must be complexed with lipids or polymers. COVID-19 vaccines use PEGylated lipid nanoparticles, and PEG is known to cause anaphylaxis. Free mRNA can signal danger to your immune system and drive inflammatory diseases. As such, injecting synthetic thermo-stable mRNA (mRNA that is resistant to breaking down) is highly problematic as it will fuel chronic, long-term inflammation.

Many commonly reported side effects from the COVID-19 gene therapy “vaccines” appear to be caused by brain inflammation and anyone with an inflammatory disease such as Rheumatoid Arthritis, Parkinson's disease or chronic Lyme, including anyone with an immune deficiency are at high risk of dying from COVID-19 mRNA vaccines.

5 months, 4 weeks ago

Who will win the battle of the isolations?

6 months ago

Around 17 years before Covid-19 and what is termed “SARS-CoV-2” there was SARS or SARS-CoV-1. But where did SARS go? And how does it relate to Covid-19?
More information: https://dreddymd.com/?s=SARS

6 months ago

An interesting run-down of the convoluted quasi-science - aka BS - behind the claim that Sars-Cov-2 causes an illness called Covid-19

6 months, 1 week ago

"AUS AKTUELLEM ANLASS"
Das erste unserer Sonderformate "Aus aktuellem Anlass" beschäftigt sich mit brisanten, akuten Fragen, Gerüchten und Theorien rund um das Thema "Corona" und allem, was damit zusammenhängt. Wenn neue Meldungen in der Öffentlichkeit die Runde machen, die das Potenzial haben, (zusätzliche) Angst, Hass und Gewalt zu schüren und die vor allem gefährliche Fehlinformationen aus dem Bereich der Medizin und Wissenschaft verbreiten, möchten wir dazu möglichst zeitnah einen Beitrag herausbringen.
Entgegen unserem Hauptprogramm ist dieses Format in erster Linie eine Stellungnahme. Das bedeutet, um verhältnismäßig zügig einen Beitrag veröffentlichen zu können, gehen wir nicht so sehr ins Detail und verweisen für genaue Belege unserer Aussagen auf unser Hauptprogramm, bei dem wir in jedem Beitrag ein detailliertes Quellenverzeichnis veröffentlichen.

Da alle Themen, die wir in Projekt Immanuel behandeln in direktem Zusammenhang stehen, lassen sich auch alle Inhalte unserer Sonderformate mit den Quellen aus dem Hauptprogramm belegen.

- - -

A.A.A., Nr. 01: "Biowaffen - der Mythos vom künstlichen Krankheitserreger"
In der ersten Folge unseres Sonderformates "Aus aktuellem Anlass" beschäftigen wir uns mit dem Thema Biologische Kriegsführung/Biowaffen. Dabei gehen wir aufgrund der neuesten Gerüchte rund um das angebliche "Wuhan-Virus" aus dem Labor speziell auf das Thema künstliche, d.h. in einem Labor modifizierte oder kreierte "Krankheitserreger" ein und erklären, warum diese bis zum heutigen Tag nur ein Mythos sind und auch ganz sicher immer nur ein Mythos bleiben werden.

- - -

Projekt Immanuel ist ein gemeinnütziges Projekt. Unsere Beiträge sollen frei zugänglich sein und sind für alle Menschen gedacht. Unter der Voraussetzung, dass an unseren Veröffentlichungen absolut NICHTS VERÄNDERT wird, darf jedes unserer Videos und Dokumente heruntergeladen, weitergegeben und auf eigenen Kanälen wieder hochgeladen werden. Bei unseren Videos muss zusätzlich die vollständige Videobeschreibung mit übernommen werden!

Auf welchen Portalen und in welchen Sprachen unsere Beiträge veröffentlicht werden, erfahren Sie auf unserer Webseite.

- - -

Wenn Sie uns kontaktieren möchten, nutzen Sie hierfür folgende Adresse:
[email protected]

Alle Infos zu neuen Beiträgen erhalten sie auf unserer Webseite oder in unserer Telegram-Gruppe.

Webseite: www.projekt-immanuel.de
Telegram: t.me/projekt_immanuel

- - -

WEITERFÜHRENDE LINKS

Thomas Schnelle: "Ludwig Fleck - Leben und Denken. Zur Entstehung und Entwicklung des wissenschaftlichen Denkstils in der Wissenschaftsphilosophie", Januar 1982
https://www.researchgate.net/publication/319630084_Ludwik_Fleck_-_Leben_und_Denken_Zur_Entstehung_und_Entwicklung_des_wissenschaftlichen_Denkstils_in_der_Wissenschaftsphilosophie_Freiburg_1982
veröffentlicht auf ResearchGate

Ludwig Fleck - "Entstehung und Entwicklung einer wissenschaftlichen Tatsache - Einführung in die Lehre vom Denkstil und Denkkollektiv", 1980
https://www.suhrkamp.de/buecher/entstehung_und_entwicklung_einer_wissenschaftlichen_tatsache-ludwik_fleck_27912.html
Suhrkamp Verlag (kann direkt beim Verlag bestellt werden)

"Project MKULTRA, the CIA's Program of Research into Behavioral Modification - Joint Hearing before the Select Committee on Intelligence and the Subcommittee on Health and Scientific Research of the Committee on Human Resources, United State Senate, Ninety-Fifth Congress, First Session", 03. August 1977
https://www.nytimes.com/packages/pdf/national/13inmate_ProjectMKULTRA.pdf
veröffentlicht auf der Webseite der New York Times

Bücher in deutscher Sprache von Eugen Rosenstock-Huessy zu bekommen ist leider nicht ganz einfach, da sie nicht mehr neu aufgelegt werden. Wir können aber dringend empfehlen, danach zu suchen und sich ggf. alte gebrauchte Exemplare zu kaufen. Es lohnt sich!

6 months, 1 week ago

En este video queremos presentarles el Proyecto Immanuel mediante el cual trataremos el trasfondo científico de la “crisis del coronavirus”. Con ayuda del experimentado científico y virólogo Dr. Stefan Lanka estamos desarrollando una serie de videos y artículos que pondrán bajo la lupa y analizarán todas las publicaciones científicas principales relacionadas con la temática del SARS-CoV-2 y la COVID-19. Nuestro objetivo principal es hacer comprensible y accesible la ciencia a todas las personas. Todos los conceptos técnicos y procedimientos científicos propios de la virología y la microbiología, cuya compresión es necesaria, serán explicados de manera sencilla con multitud de ejemplos.

Este es un proyecto científico. Esto implica que, por mucho que cuestionemos todo lo que se haya hecho y haya sucedido durante la crisis del coronavirus, nuestra postura se mantendrá siempre neutral. Ni nos posicionamos a favor de nadie ni juzgamos a nadie. Analizamos todo desde una perspectiva puramente científica y médica. Por otra parte, ¡le pedimos a los espectadores que no nos crean sin más! Todo lo contrario, duden, sean críticos y cuestiónennos. Aquel que pueda rebatir nuestras afirmaciones está cordialmente invitado a hacerlo siempre y cuando aporte argumentos sólidos y verificables. Si hemos cometido errores estamos más que dispuestos a corregirlos.

Detrás del Proyecto Immanuel hay un pequeño grupo de cineastas independientes que quisiera dar a conocer una serie de hechos científicos para su escrutinio público, los cuales son desconocidos para la mayoría de la población por el mero hecho de que no concuerdan con la visión del mundo predominante ni con el consiguiente consenso unánime existente.

El Proyecto Immanuel es un proyecto sin ánimo de lucro. El material que publiquemos será de acceso gratuito y pensado para todo el mundo. Nuestros videos y documentos podrán ser descargados, compartidos y subidos a canales propios bajo la condición de que NO SE MODIFIQUE NADA de su contenido. ¡En el caso de los videos es obligatorio compartir también la descripción completa adjunta al mismo!
Por medio de nuestra web informaremos acerca de las plataformas en las que estarán disponibles nuestros videos y artículos, así como en los idiomas en los que estarán traducidos.

- - -

Si quieren contactarnos pueden escribirnos a esta dirección:
[email protected]

Informaremos periódicamente sobre nuevas publicaciones en nuestra página web o en nuestro grupo de Telegram.

Página web: www.projekt-immanuel.de
Telegram: t.me/projekt_immanuel

NUESTROS CANALES DE VIDEO
Bitchute: www.bitchute.com/projekt-immanuel
Dailymotion: https://www.dailymotion.com/dm_098181bca1aded04ba222830d0d2da6e
Odysee: https://odysee.com/@Projekt-Immanuel:3

- - -

Traducido y doblado por el equipo de "MaterialdeNMG" (www.materialdenmg.com)

- - -

FUENTES

(1) "A new coronavirus associated with human respiratory disease in China”
PUBLICACIÓN: "A new coronavirus associated with human respiratory disease in China”
AUTORES: Fan Wu, Su Zhao, Bin Yu, Yan-Mei Chen et al.
REVISTA: Nature
EDICIÓN: volumen 579, (publicación en línea el 3 de febrero de 2020) 12 de marzo de 2020 (p. 265-269) [https://doi.org/10.1038/s41586-020-2008-3]
LOCALIZACIÓN: https://www.nature.com/articles/s41586-020-2008-3

(2) "A Novel Coronavirus from Patients with Pneumonia in China, 2019"
PUBLICACIÓN: "A Novel Coronavirus from Patients with Pneumonia in China, 2019"
AUTORES: Na Zhu, Ph.D., Dingyu Zhang, M.D., Wenling Wang, Ph.D., Xingwang Li, M.D. et al.
REVISTA: New England Journal of Medicine
EDICIÓN: No. 8, volumen 382, 24 de enero de 2020 [actualizado el 29 de enero de 2020] (p. 727-733)
FUENTE: N Engl J Med 2020;382:727-33. DOI: 10.1056/NEJMoa2001017
LOCALIZACIÓN: https://www.nejm.org/doi/full/10.1056/NEJMoa2001017

(3) "Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR"
PUBLICACIÓN: "Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR”
AUTORES: Christian Drosten, Olfert Landt et al.
REVISTA: Eurosurveillance
EDICIÓN: No. 3, volumen 25, 23 de enero de 2020 (p. 727-733)
FUENTE: Euro Surveill. 2020;25(3):pii=2000045.
https://doi.org/10.2807/1560-7917.ES.2020.25.3.2000045
LOCALIZACIÓN: https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.3.2000045

6 months, 4 weeks ago

Originaltext zum Video:
In diesem Video möchten wir ihnen das Projekt Immanuel vorstellen, das sich kritisch mit den wissenschaftlichen Hintergründen der sogenannten "Corona-Krise" auseinandersetzt. Mit der Hilfe des erfahrenen Naturwissenschaftlers und Virologen Dr. Stefan Lanka werden in einer ganzen Reihe von Beiträgen alle grundlegenden Publikationen zu SARS-CoV-2 und COVID-19 genau unter die Lupe genommen und wissenschaftlich geprüft.

Dabei liegt unser Hauptaugenmerk darauf, die Wissenschaft allen Menschen verständlich zu machen. Alle nötigen Fachbegriffe und wissenschaftlichen Verfahren der Virologie und Mikrobiologie, die man kennen und verstehen muss, werden für jedermann leicht verständlich erklärt und mittels vieler Beispiele veranschaulicht.

Dies ist ein wissenschaftliches Projekt. Das bedeutet zum einen, auch wenn wir all das, was in der Corona-Krise getan wurde und geschehen ist, sehr kritisch hinterfragen, bleiben wir stets neutral. Weder ergreifen wir Partei für jemanden noch verurteilen wir irgendwen. Wir analysieren alles aus einer rein wissenschaftlich-medizinischen Sicht.

Zum anderen bedeutet es, dass wir Sie als Zuschauer ausdrücklich dazu auffordern, keine unserer Aussagen einfach zu glauben! Im Gegenteil, zweifeln Sie, seien Sie kritisch und hinterfragen Sie uns. Wer unsere Aussagen widerlegen kann, ist hiermit herzlich eingeladen, das zu tun, sollte jedoch mit handfesten, überprüfbaren Fakten argumentieren. Sollten wir wirklich Fehler gemacht haben, sind wir gerne bereit, diese zu korrigieren.

Hinter Projekt Immanuel steht eine kleine Gruppe unabhängiger Filmemacher, die mithelfen möchte, wissenschaftliche Fakten in die Öffentlichkeit zu tragen, die vom Großteil der Menschen nur deshalb ignoriert werden, weil sie nicht dem vorherrschenden Weltbild und dem anerkannten Konsens entsprechen.

Projekt Immanuel ist ein gemeinnütziges Projekt. Unsere Beiträge sollen frei zugänglich sein und sind für alle Menschen gedacht. Unter der Voraussetzung, dass an unseren Veröffentlichungen absolut NICHTS VERÄNDERT wird, darf jedes unserer Videos und Dokumente heruntergeladen, weitergegeben und auf eigenen Kanälen wieder hochgeladen werden. Bei unseren Videos muss zusätzlich die vollständige Videobeschreibung mit übernommen werden!

Auf welchen Portalen und in welchen Sprachen unsere Beiträge veröffentlicht werden, erfahren Sie auf unserer Webseite.

Wenn Sie uns kontaktieren möchten, nutzen Sie hierfür folgende Adresse:
[email protected]

Alle Infos zu neuen Beiträgen erhalten sie auf unserer Webseite oder in unserer Telegram-Gruppe.

Webseite: www.projekt-immanuel.de
Telegram: t.me/projekt_immanuel

Quellen:
(1) "A new coronavirus associated with human respiratory disease in China”
PUBLIKATION: "Ein neues Coronavirus im Zusammenhang mit menschlichen Atemwegserkrankungen in China" [Englisch]
AUTOREN: Fan Wu, Su Zhao, Bin Yu, Yan-Mei Chen et al.
MAGAZIN: "Nature" - AUSGABE: Band 579, (online Veröffentlichung am 03. Februar 2020) 12. März 2020 (S. 265-269)
QUELLE: doi.org/10.1038/s41586-020-2008-3

Fundort: www.nature.com/articles/s41586-020-2008-3

(2) "A Novel Coronavirus from Patients with Pneumonia in China, 2019"
PUBLIKATION: "Ein neuartiges Coronavirus von Patienten mit Lungenentzündung in China, 2019" [Englisch]
AUTOREN: Na Zhu, Ph.D., Dingyu Zhang, M.D., Wenling Wang, Ph.D., Xingwang Li, M.D. et al.
MAGAZIN: "New England Journal of Medicine" - AUSGABE: Nr. 8, Band 382, 24. Janaur 2020 [aktualisiert am 29. Januar 2020] (S. 727-733)
QUELLE: "N Engl J Med 2020;382:727-33. DOI: 10.1056/NEJMoa2001017"

Fundort: www.nejm.org/doi/full/10.1056/NEJMoa2001017

(3) "Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR"
PUBLIKATION: "Nachweis des neuartigen Coronavirus von 2019 (2019-nCoV) mittels Echtzeit-RT-PCR" [Englisch]
AUTOREN: Christian Drosten, Olfert Landt et al.
MAGAZIN: "Eurosurveillance" - AUSGABE: Nr. 3, Band 25, 23. januar 2020 (S. 727-733)
QUELLE: "Euro Surveill. 2020;25(3):pii=2000045. https://doi.org/10.2807/1560-7917.ES.2020.25.3.2000045"

Fundort: www.eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.3.2000045

Video geteilt am 30.12.2020 ( Quelle: odysee.com/@Projekt-Immanuel:3/Ankuendigung:9 )

Anmerkung: Auf dem Telegram-Kanal "Corona_Fakten" wird das Projekt, hoffentlich zu Recht, schon fast euphorisch mit Vorschusslorbeeren bedacht.
Zitat: "Es ist soweit, dieses Projekt wird einschlagen wie eine Bombe! Dr. rer. nat. Stefan Lanka hat es gemeinsam mit einem unabhängigen Filmemacher-Team geschafft, visuell und bis ins Detail aufzuzeigen, dass die wissenschaftliche Grundlage für die Behauptung von krankmachenden Viren bis heute nicht existiert. So gut wie alle Wissenschaftler vertrauten bis heute blind, Projekt Immanuel beendet das blinde Vertrauen und ebnet den Weg zurück in die kontrollierte Wissenschaft."

Die erste Folge der Videoreihe soll im Januar 2021 veröffentlicht werden.

7 months ago

Update from Gemma o'Doherty: " As part of our legal action we had been demanding the evidence that this virus actually exists [as well as] evidence that lock downs actually have any impact on the spread of viruses; that face-masks are safe, and do deter the spread of viruses - They don’t. No such studies exist; that social distancing is based in science - It isn't. it's made up; that contact tracing has any bearing on the spread of a virus - of course it doesn't. This organization here - is making it up as they go along." - Gemma O'Doherty. "
➡️ https://gemmaodoherty.com/defending-our-freedom/

🍀🍀🍀🍀🍀

GEMMA O'DOHERTY > PROOF SARS-COV-2 DOES NOT EXIST:
➡️ https://bitchute.com/video/sERAbw5DxIYC/

🍀🍀🍀🍀🍀

PROJECT IMMANUEL (critically examines and scrutinises all fundamental publications on Sars-CoV-2) (DR. STEFAN LANKA)
📌 https://bitchute.com/video/9pbsKaSjlfy2/

🍀🍀🍀🍀🍀

STEFAN LANKA | 'GERM THEORY' = SCIENTIFIC FRAUD:
🟠 https://bitchute.com/video/aOKX9wR1PMxA/

STEFAN LANKA - MISINTERPRETATION VIRUS
🟠 https://bitchute.com/video/SEA2QAz6UfWe/

LOUIS PASTEUR WAS A FRAUD, GERM THEORY IS FALSE:
🟠 https://bitchute.com/video/WUY46Y43Przw/

VIRUSES ARE NOT PATHOGENIC - AMANDA VOLLMER:
🟠 https://bitchute.com/video/1tIBqrt0NhAe/

THE CASE OF THE MYSTERIOUS PANDEMIC AND THE MISSING VIRUS:
🟠 https://bitchute.com/video/NkjxDk0JCTS6/

DR. COWAN: COVID19 – EVIDENCE OF GLOBAL FRAUD:
🟠 https://bitchute.com/video/4gg1BhPAaFmt/

HOW MANY PEOPLE ARE COVID (FALSE) POSITIVE? ZERO!! (DR. COWAN)
🟠 https://bitchute.com/video/gZt4pzXI6vxc/

DR. COWAN & JON RAPPOPORT: SARS-COV-2 IS AN IMAGINARY VIRUS 🧚
🟠 https://bitchute.com/video/IqsL6wXHJAaP/

Dr. Tim O'Shea $5000 FOR PROOF THAT COVID EXISTS:
🟠 https://bitchute.com/video/cgjcIdY4mMhZ/

IT'S MAGIC! 🧚 .. USE ANOTHER TEST AND COVID DISAPPEARS:
🟠 https://bitchute.com/video/piBmPprmGBAr/

🍀🍀🍀🍀🍀

💉 JERRY DAY: SAY NO TO THE VACCINE: https://bitchute.com/video/87CKNuadbFAq/

🍀🍀🍀🍀🍀

NEUROLOGIST M. GRIESZ-BRISSON: FACE MASKS CAUSE BRAIN DAMAGE:
😷 https://bitchute.com/video/nrLdCTusoX1Z/

A. Kaufman "The rooster in the river of rats" (Koch's / River's postulates:
➡️ https://bitchute.com/video/c94KOf6RsAnP/

KARY MULLIS: FAUCI SHOULDN'T BE IN THE POSITION THAT HE IS IN!
➡️ https://bitchute.com/video/IQJ2fTPvlI9D/

ALL THE WORLD'S A STAGE: WILLIAM SHAKESPEARE GETS HIS JAB
➡️ https://bitchute.com/video/aF0YMTEGNmJJ/

CRIMES AGAINST HUMANITY (CORONA SCANDAL):
➡️ https://bitchute.com/video/C6Na6L83BiX8/

➡️ PATHOLOGIST DR. R. HODKINSON: "COVID IS THE GREATEST HOAX EVER!" https://bitchute.com/video/UOCbOfQjPjG9/

🍀🍀🍀🍀🍀

RECOMMENDED:
➡️ L.Scheff: Children were subjected to toxic AIDS drugs: https://bitchute.com/video/ch6xQHnKHmNu/
➡️ HIV / AIDS = FAUCI'S FIRST FRAUD: https://bitchute.com/video/xwKIEPpPpmzv/
➡️ Dr. Lanka Measles Court Case: https://bitchute.com/video/5GINdlpUSW8E/
➡️ Why Gates switched from Microsoft to vaccines: https://bitchute.com/video/RJQU9uhSx7HC/
➡️ THE ROCKEFELLERS AND THE FDA: https://bitchute.com/video/3KvZKxoUDFTR/
➡️ Rockefeller, healthcare and big pharma: https://bitchute.com/video/okUftjUP8ANS/
➡️ DR. HUMPHRIES -THE HISTORY OF VACCINATION: https://bitchute.com/video/DE7iXEkVdC40/
➡️ DR. PETRELLA: COVID IS A DEADLY OPERATION! https://bitchute.com/video/Qzqge2JVo5dV/
➡️ RAUNI KILDE, SWINE FLU AND DEATHLY VACCINES: https://bitchute.com/video/FX7ZXD6wNF5h/
➡️ VACCINES AND SPANISH FLU: https://bitchute.com/video/XDZ7ABOvfxrm/

7 months, 1 week ago

November 13th, 2020 - Here is Dr. Roger Hodkinson addressing the Community and Public Services Committee, on the Covid measures implemented in Canada. Dr. Hodkinson is the Chairman of the Royal College of Physicians and Surgeons committee in Ottawa, CEO of a large private medical laboratory in Edmonton, Alberta and Chairman of a Medical Biotechnology company, which sells a Covid-19-test.

7 months, 1 week ago

Professor Fourtillan, who appeared in "Hold-Up", he has been interned in a psychiatric hospital against his will. Jean Bernard Fourtillan professor of pharmacology and toxicology speaks out about the origin of SARS CoV virus. He is a hero among the heroes.

Fourtillan exposing the SARS-COV- 2 conspiracy. They faked it so that they could roll out the genocidal vaccine. This is why they locked him up.

I found this video here: https://www.brighteon.com/545b716a-ac9b-4410-9077-79429cf92449 where the writer states:
"I would add that it looks to me as if the purpose of the vaccine is to make sure that the Covid-19 biological weapon goes viral everywhere. So far, all this talk of asymptomatic carriers has been bollocks, but once ignorant, dangerous people willingly take the vaccine, they will become real asymptomatic carriers and god help the rest of us who wouldn't touch the vaccine with a bloody barge pole! In my view, these dangerous vaccine-takers should be isolated on some godforsaken island reserved for the monumentally stupid and kept well away from the rest of us so they can't infect us. We'll send all the vaccine-pushing politicians to live with them."

There are many others making comments that lead down the same road - the fact that they have locked up Fourtillan should send shivers down anyone's spine. His comments agree with earlier information in this video: https://www.bitchute.com/video/LtyVhYr9TNtY/

Credits to:
Un Héros à l'assaut du Mal | Channel 'Vivre sur le Fil' | 05/12/2020: https://www.youtube.com/watch?v=TIihEpfxCyI
Un lanceur d'alerte et Professeur interné de force! | Channel Terra- Formations | 10/12/2020: https://www.youtube.com/watch?v=2b4dzRZVAo8
The family asks not to call the hospital anymore, the lawyers will take care of it, thank you all.
See article from France Soir: : http://www.francesoir.fr/societe-faits-divers/alerte-info-le-pr-fourtillan-qui-est-apparu-dans-hold-interne-en-hopital
Video of an informed lawyer: https://www.youtube.com/watch?v=79HEa_6AIxU

7 months, 2 weeks ago

In diesem Video möchten wir ihnen das Projekt Immanuel vorstellen, das sich kritisch mit den wissenschaftlichen Hintergründen der sogenannten "Corona-Krise" auseinandersetzt. Mit der Hilfe des erfahrenen Naturwissenschaftlers und Virologen Dr. Stefan Lanka werden in einer ganzen Reihe von Beiträgen alle grundlegenden Publikationen zu SARS-CoV-2 und COVID-19 genau unter die Lupe genommen und wissenschaftlich geprüft.
Dabei liegt unser Hauptaugenmerk darauf, die Wissenschaft allen Menschen verständlich zu machen. Alle nötigen Fachbegriffe und wissenschaftlichen Verfahren der Virologie und Mikrobiologie, die man kennen und verstehen muss, werden für jedermann leicht verständlich erklärt und mittels vieler Beispiele veranschaulicht.

Dies ist ein wissenschaftliches Projekt. Das bedeutet zum einen, auch wenn wir all das, was in der Corona-Krise getan wurde und geschehen ist, sehr kritisch hinterfragen, bleiben wir stets neutral. Weder ergreifen wir Partei für jemanden noch verurteilen wir irgendwen. Wir analysieren alles aus einer rein wissenschaftlich-medizinischen Sicht.
Zum anderen bedeutet es, dass wir Sie als Zuschauer ausdrücklich dazu auffordern, keine unserer Aussagen einfach zu glauben! Im Gegenteil, zweifeln Sie, seien Sie kritisch und hinterfragen Sie uns. Wer unsere Aussagen widerlegen kann, ist hiermit herzlich eingeladen, das zu tun, sollte jedoch mit handfesten, überprüfbaren Fakten argumentieren. Sollten wir wirklich Fehler gemacht haben, sind wir gerne bereit, diese zu korrigieren.

Hinter Projekt Immanuel steht eine kleine Gruppe unabhängiger Filmemacher, die mithelfen möchte, wissenschaftliche Fakten in die Öffentlichkeit zu tragen, die vom Großteil der Menschen nur deshalb ignoriert werden, weil sie nicht dem vorherrschenden Weltbild und dem anerkannten Konsens entsprechen.

- - -

Projekt Immanuel ist ein gemeinnütziges Projekt. Unsere Beiträge sollen frei zugänglich sein und sind für alle Menschen gedacht. Unter der Voraussetzung, dass an unseren Veröffentlichungen absolut NICHTS VERÄNDERT wird, darf jedes unserer Videos und Dokumente heruntergeladen, weitergegeben und auf eigenen Kanälen wieder hochgeladen werden. Bei unseren Videos muss zusätzlich die vollständige Videobeschreibung mit übernommen werden!

Auf welchen Portalen und in welchen Sprachen unsere Beiträge veröffentlicht werden, erfahren Sie auf unserer Webseite.

- - -

Wenn Sie uns kontaktieren möchten, nutzen Sie hierfür folgende Adresse:
[email protected]

Alle Infos zu neuen Beiträgen erhalten sie auf unserer Webseite oder in unserer Telegram-Gruppe.

Webseite: www.projekt-immanuel.de
Telegram: t.me/projekt_immanuel

- - -

Quellen:

(1) "A new coronavirus associated with human respiratory disease in China”
PUBLIKATION: "Ein neues Coronavirus im Zusammenhang mit menschlichen Atemwegserkrankungen in China" [Englisch]
AUTOREN: Fan Wu, Su Zhao, Bin Yu, Yan-Mei Chen et al.
MAGAZIN: "Nature" - AUSGABE: Band 579, (online Veröffentlichung am 03. Februar 2020) 12. März 2020 (S. 265-269)
QUELLE: https://doi.org/10.1038/s41586-020-2008-3

Fundort: https://www.nature.com/articles/s41586-020-2008-3

(2) "A Novel Coronavirus from Patients with Pneumonia in China, 2019"
PUBLIKATION: "Ein neuartiges Coronavirus von Patienten mit Lungenentzündung in China, 2019" [Englisch]
AUTOREN: Na Zhu, Ph.D., Dingyu Zhang, M.D., Wenling Wang, Ph.D., Xingwang Li, M.D. et al.
MAGAZIN: "New England Journal of Medicine" - AUSGABE: Nr. 8, Band 382, 24. Janaur 2020 [aktualisiert am 29. Januar 2020] (S. 727-733)
QUELLE: "N Engl J Med 2020;382:727-33. DOI: 10.1056/NEJMoa2001017"

Fundort: https://www.nejm.org/doi/full/10.1056/NEJMoa2001017

(3) "Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR"
PUBLIKATION: "Nachweis des neuartigen Coronavirus von 2019 (2019-nCoV) mittels Echtzeit-RT-PCR" [Englisch]
AUTOREN: Christian Drosten, Olfert Landt et al.
MAGAZIN: "Eurosurveillance" - AUSGABE: Nr. 3, Band 25, 23. januar 2020 (S. 727-733)
QUELLE: "Euro Surveill. 2020;25(3):pii=2000045. https://doi.org/10.2807/1560-7917.ES.2020.25.3.2000045"

Fundort: https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.3.2000045

7 months, 2 weeks ago

The article: https://off-guardian.org/2020/11/17/covid19-evidence-of-global-fraud/ .

Excerpt: .."The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find. The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2. However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes." ..

Read the comments / debate under the article, very informative and it reflects the confusion that (still) exists among many.

Dr. Cowan on Bitchute: https://www.bitchute.com/drtomcowan/

🍀🍀🍀🍀🍀

PROJECT IMMANUEL (critically examines and scrutinises all fundamental publications on Sars-CoV-2) (DR. STEFAN LANKA)
📌 https://bitchute.com/video/9pbsKaSjlfy2/

🍀🍀🍀🍀🍀

𝗦𝗧𝗔𝗧𝗘𝗠𝗘𝗡𝗧 𝗢𝗡 𝗩𝗜𝗥𝗨𝗦 𝗜𝗦𝗢𝗟𝗔𝗧𝗜𝗢𝗡 (𝗦𝗢𝗩𝗜)
🔔 https://drtomcowan.com/sovi

🍀🍀🍀🍀🍀

DR. COWAN & JON RAPPOPORT: SARS-COV-2 IS AN IMAGINARY VIRUS 🧚
➡️ https://bitchute.com/video/IqsL6wXHJAaP/

Dr. Cowan debunks peer reviewed papers on isolation sars-cov-2:
➡️ https://bitchute.com/video/jwQV79H88CBs/

Dr. Cowan on the inconsistencies in the covid story:
➡️ https://bitchute.com/video/3Gy2sddhd6b7/

HOW MANY PEOPLE ARE COVID (FALSE) POSITIVE? ZERO!! (DR. TOM COWAN)
➡️ https://bitchute.com/video/gZt4pzXI6vxc/

DR. COWAN EXPLAINS 'VIRUS MUTATIONS'
➡️ https://bitchute.com/video/xtcO2y9r5jNU/

🍀🍀🍀🍀🍀

DR. G. DOWNING: OUR DNA CODES UNDER ATTACK:
🔖 https://bitchute.com/video/3XOeWrdBCupb/

DER FALL DROSTEN - REINER FÜLLMICH / DAVE BRYCH:
🔖 https://bitchute.com/video/jzEMQw162APx/

CDC: A specimen of a real virus was never available:
🔖 https://bitchute.com/video/fr9v0GO64p35/

GEMMA O'DOHERTY > PROOF SARS-COV-2 DOES NOT EXIST.
🔖 https://bitchute.com/video/sERAbw5DxIYC/

🍀🍀🍀🍀🍀

Dr. Lanka - 'germ theory' = scientific fraud:
➡️ https://bitchute.com/video/aOKX9wR1PMxA/

Dr. Lanka Measles Court Case:
➡️ https://bitchute.com/video/5GINdlpUSW8E/

Dr. S. Lanka, The Infectious Myth:
➡️ https://bitchute.com/video/04pyhDltPrMU/

Louis Pasteur was a fraud:
➡️ https://bitchute.com/video/WUY46Y43Przw/

Aajonus Vonderplanitz dismantles the virus myth:
➡️ https://bitchute.com/video/UHFNVCXgOA37/

You cannot catch a virus! (Tom Barnett)
➡️ https://bitchute.com/video/VeImUAiLlmcv/

🍀🍀🍀🍀🍀

INFLUENZA 1918 SCRIPT; RINSE REPEAT > COVID-19:
➡️ https://bitchute.com/video/6eKF4nzGcXiP/

A. Kaufman: Koch's postulates:
➡️ https://bitchute.com/video/c94KOf6RsAnP/

MD OFFERS $5000 FOR PROOF THAT COVID EXISTS:
➡️ https://bitchute.com/video/cgjcIdY4mMhZ/

L. Scheff: what journalists get wrong: viruses / pandemics:
➡️ https://bitchute.com/video/KKmXt1b2YcsB/

L. Scheff: Vaccines, science or pseudo science?
➡️ https://bitchute.com/video/X4L7rrVQguU6/

🍀🍀🍀🍀🍀

Kary Mullis - PCR Test-not-a-test:
➡️ https://bitchute.com/video/LsD3GfigvsJX/

Dr. Willner injects himself with HIV:
➡️ https://bitchute.com/video/Yo5o98vppwIN/

DR GIRALDO - everybody is hiv positive!!
➡️ https://bitchute.com/video/nkMN1kr0eukR/

Deconstructing The AIDS Myth:
➡️ https://bitchute.com/video/2Q83yDG115oC/

House of Numbers - the HIV/AIDS story:
➡️ https://bitchute.com/video/lohmnsGaLy2X/

Dr. Köhnlein interview House of Numbers:
➡️ https://bitchute.com/video/FTytxqTeXNxe/

HIV / AIDS = FAUCI'S FIRST FRAUD:
➡️ https://bitchute.com/video/xwKIEPpPpmzv/

The Infectious Myth - David Crowe:
➡️ https://bitchute.com/video/QbjP8sO2qCq2/

Dr. Papadopulos: HIV was never proven:
➡️ https://bitchute.com/video/MVabU0seKNMH/

🍀🍀🍀🍀🍀

Virus Mania: C. Markolin, Ph.D. (pt.2)
➡️ https://bitchute.com/video/0SIeRUxrgW1n/

Virus Mania: C. Markolin, Ph.D. (pt.1)
➡️ https://bitchute.com/video/XRCxanRMLGkT/

Germs, The Terrain & our Future:
➡️ https://bitchute.com/video/0Hh4k27cXPxv/

7 months, 3 weeks ago

Re-Upload von https://youtu.be/N-NiDI_pKnY 22. Nov. 2020 - Ein Rundumschlag

8 months ago

Keine Schwangerschaft mehr möglich! Wolfgang Wodarg erklärt hier verständlich wie durch die kommende mRNA-Impfung eine Unfruchtbarkeit herbeigerührt werden kann.

8 months ago

COVID-19 TEST KITS PURCHASED AND RECEIVED IN 2017 AND 2018 GLOBALLY

🍀🍀🍀🍀🍀

REMINDER: ROTHSCHILD PATENTED COVID-19 BIOMETRIC TESTING IN 2015 (NL) AND 2017 (US):
➡️ https://bitchute.com/video/u2cPIpxMXshN/

SCIENTISTS CALL FOR A GLOBAL DNA DATABASE:
➡️ https://bitchute.com/video/WaHWMhA8j6oa/

MICROSOFT WO2020060606 patent - CRYPTOCURRENCY SYSTEM USING BODY ACTIVITY DATA - Publication Date 26.03.2020
⚠️ http://bit.ly/PATENT2020060606

NEW TECH VACCINES - TRACK AND TRACE HUMANITY 'CONSPIRACY' FACTS
➡️ https://bitchute.com/video/D5KExUGWhzrD/

NANOTECH BLOCKCHAIN, READY FOR COVID-19 IMMUNITY PASSPORTS:
➡️ https://www.covidtruth.info/nano-tech-blockchain-ready-for-covid-19-immunity-passports/

You have a secret health score and it's as dystopian as it sounds:
➡️ https://bitchute.com/video/rmZbWTLLV0Zv/

🍀🍀🍀🍀🍀

It was all planned, pandemics are SMOKE SCREENS:

➡️ Is Dr. Drosten (covid19 test) an imposter, a fraud? https://bitchute.com/video/hdr29jrGNgMz/
➡️ Operation Lockstep 2010 to Control Humanity: https://bitchute.com/video/gzod1Uq9GXr3/
➡️ CDC: a specimen of a real virus is not available: https://bitchute.com/video/fr9v0GO64p35/
➡️ Kary Mullis, inventor of PCR TEST-NOT-A-TEST: https://bitchute.com/video/LsD3GfigvsJX/
➡️ GEMMA O'DOHERTY, PROOF SARS-COV-2 DOES NOT EXIST https://bitchute.com/video/sERAbw5DxIYC/
➡️ Harry Vox: "our lives are in danger" https://bitchute.com/video/3Dbacl9qkFgv/
➡️ Aaron Russo about the Rockefellers and the NWO: https://bitchute.com/video/ML9lE6D7iqJP/
➡️ Dr. Coleman - "everything that happened was meant to happen" : https://bitchute.com/video/rCPqSRcLg3Z3/

🍀🍀🍀🍀

Jon Rappoport / THE CREATION OF A FALSE EPIDEMIC:
➡️ Ep1: HOW IT STARTED >> https://bitchute.com/video/q5h0CeSrnwWs/
➡️ Ep2: THE MEDICAL CIA, COVERT OPS >> https://bitchute.com/video/CD2fctN9l7hJ/
➡️ Ep3: THE TRUE GOAL OF THE FALSE PANDEMIC >> https://bitchute.com/video/qX2M0umDu10S/

🍀🍀🍀🍀

8 months, 2 weeks ago

"𝙏𝙝𝙚 𝙜𝙧𝙚𝙖𝙩𝙚𝙨𝙩 𝙛𝙧𝙖𝙪𝙙 𝙚𝙫𝙚𝙧 𝙥𝙚𝙧𝙥𝙚𝙩𝙪𝙖𝙩𝙚𝙙 𝙤𝙣 𝙝𝙪𝙢𝙖𝙣𝙞𝙩𝙮"
Gemma O'Doherty is an Investigative Journalist in Ireland. This Irish Investigation into Covid shows that The Department of health refuse to confirm existence of a “virus” in writing.Confirmation that the virus was never isolated. On top of this, the CDC in July revealed that there is no Covid-19 in a document titled "CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic panel", dated July 13, 2020. On Page 39 of this document titled "Performance Characteristics", we see written "Since no quantified virus isolates of the 2019-nCoV are currently available..." So... What are they testing for? Because it's not the virus... That hasn't been proved to exist... What is being tested for is RNA that is PRESUMED to come from the virus... Which hasn't been proven to exist...
So, what are people dying of? Well... The same thing they die of every year!

8 months, 4 weeks ago

MAGAZINE NEXUS : https://www.youtube.com/channel/UCJRVmR4NWAKIx-e-c40qKxQ

Le débat sur l’origine du virus reste plus que jamais ouvert : « Cette séquence (ndlr : présente dans le sars-cov2) découpable par le furine au milieu de protéines membranaires virales (ndlr : S1 et S2) a déjà fait l’objet d’un brevet. Là, cette séquence est idéalement située comme suggéré dans ce brevet », Alexandra Henrion-Caude, généticiennne. (interview du 29 octobre)

👉 Revoir notre première interview du 13 octobre : https://www.youtube.com/watch?v=lvO5L...

Sources :
Lien vers le brevet : https://patentimages.storage.googleap...

« La question de l'origine du SARS-CoV-2 se pose sérieusement », article CNRS : https://lejournal.cnrs.fr/articles/la...

👉 Suivez-nous sur la page Facebook de NEXUS pour ne rien rater de nos prochaines actualités : https://www.facebook.com/magazine.nexus/

📬📱 Notre magazine papier #NEXUS est sans pub ! Abonnez-vous pour nous soutenir et pour garantir une information totalement indépendante ! ✰ https://www.nexus.fr

🤓❤️ NOUS AVONS BESOIN DE VOUS ! Nexus vous propose du contenu web gratuit, un magazine et un site internet sans pub. Pour que nous puissions continuer notre travail vous pouvez :
✅ Faire un DON sur Tipeee ou PayPal : https://fr.tipeee.com/nexus-magazine / https://www.paypal.com/paypalme/nexusdon
✅ Vous abonner au magazine Papier & Numérique : https://bit.ly/AboNexus
✅ Acheter nos numéros à l'unité : https://bit.ly/FeuilleterNexus
#Covid19 #Nexus

8 months, 4 weeks ago

Hint it has nothing to do with the rate of infection and everything to do with how federal laws were violated to change data collection for COVID.

Peer-reviewed Full Length Paper
https://www.publichealthpolicyjournal.com/ethics-in-science-and-technololgy

Contact the Department of Justice to Demand a Grand Jury Investigation
https://www.justice.gov/disaster-fraud/webform/ncdf-disaster-complaint-form

On behalf of all Americans we call upon the Department of Justice and all US Attorneys, pursuant to 18 USC 3332, to immediately act upon our formal petition & supporting exhibits in order to launch formal STATE GRAND JURY and/or SPECIAL FEDERAL GRAND JURY investigations into how the CDC violated federal law to fraudulently inflate COVID-19 case and fatality data.

Independently peer-reviewed research ‘COVID-19 Data Collection, Comorbidity & Federal Law: A Historical Retrospective’ reveals that the CDC willfully violated multiple FEDERAL LAWS (APA, PRA, IQA), intentionally compromised data accuracy and integrity in order to make FALSE STATEMENTS (18 USC §1035, 18 USC §1001) to the American People regarding COVID-19 data and in doing so have engaged in a CONSPIRACY TO DEFRAUD THE UNITED STATES (18 USC §371, 18 USC §1031).

9 months ago

"Lies, Damned Lies and Statistics" (Rachel Elnaugh, 20. Oct. 2020):
https://www.youtube.com/watch?v=QFU468UYRQg

"COVID19 PCR Tests are Scientifically Meaningless":
https://off-guardian.org/2020/06/27/covid19-pcr-tests-are-scientifically-meaningless/

There is no SARS-CoV-2 that has ever been proven infectious/contagious !

"The Contagion Myth : Why Viruses (Including Coronavirus) Are Not the Cause of Disease":
https://www.booksamillion.com/p/Contagion-Myth/Thomas-S-Cowan/9781510764620

"A deeper look into the statistics which are being presented to increase levels of FEAR and justify lockdowns... Based on statistics available on 20 October 2020.

For a more detailed video on The Great Reset watch 'Rachel's Rabbit Hole Roundup 18 October 2020' also on this channel."

9 months ago

For amplification ..

https://blog.nomorefakenews.com/2020/10/08/the-smoking-gun-where-is-the-coronavirus-the-cdc-says-it-isnt-available/

Yes, I did first attempt to upload this to Youtube ..

They took it down in less than 30 minutes ..

Said I violated community guidelines ..

RE: "deceptive practice; scam"

I appealed stating that I only published an official govt document; stating only the contents in that document (from the CDC itself) with no more added than a TWO word paraphrase ..

They denied my appeal with no further explanation ..

I guess we know for certain now that Youtube/Google/Alphabet is firmly in the pocket of Big Pharma, et al ..

Please share liberally ..

9 months, 1 week ago

The Disruption Corona Press Conference Denmark Sept 29th 2020...the missing virus [SARS-CoV-2]…

The access to documents request on SARS-CoV-2 mentioned in the video can be found here (Danish) :
https://www.fluoridefreepeel.ca/wp-content/uploads/2020/10/Denmark-The-Statens-Serum-Instituttet-SARS-COV-2-FOI-reply-Afgoerelse_Alex_Holmstedt_SAG_20-08162__1_.pdf

Access to documents request regarding proof of existence of the alleged New Coronavirus SARS-CoV-2
from all over the world can be found here :
https://www.fluoridefreepeel.ca/fois-reveal-that-health-science-institutions-around-the-world-have-no-record-of-sars-cov-2-isolation-purification/

9 months, 1 week ago

"The COVID Narrative Unravels" (The HighWire with Del Bigtree, 16. October 2020):
https://thehighwire.com/videos/THE-COVID-NARRATIVE-UNRAVELS/

"COVID19 PCR Tests are Scientifically Meaningless":
https://off-guardian.org/2020/06/27/covid19-pcr-tests-are-scientifically-meaningless/

"Death during COVID-vaccine-trial" (The HighWire with Del Bigtree, 22. October 2020):
https://www.bitchute.com/video/0ybtREoBHwhE/

Rise up now !

"W.H.O. Flips on Lockdown; ‘MASK’ERADE Exposed by CDC?; Dr. Bartlett’s COVID-19 ‘Silver Bullet’; Piece of the Covid Mortality Puzzle Found?

#TwitterCensorship #Masks #FluShot #CovidSilverBullet #OpenYourEyes".

9 months, 2 weeks ago

SENSATION! Greek researcher succeeds in sequencing SARS-CoV-2 from prehistoric material!

9 months, 2 weeks ago

Danish: "Velkommen til Retardistan" (dkdox.tv, 8. oktober 2020):
https://www.youtube.com/watch?v=bNAy8q5Gms0

"Befolkningen bliver ført bag lyset":
https://www.youtube.com/watch?v=vm44ocioG78

Trusler om bøder for en virus, der ikke eksisterer, for en test, der ikke har skyggen af belæg, for masker, der ikke beskytter mod noget som helst, men kun forårsager iltmangel. Det er ét stort bedrageri af de såkaldte herskere. De hersker bare ikke over os!

Husk på, at samfundet og "staten" er to helt forskellige ting. Man kan sagtens ville samfundet, men ikke ville "staten".

https://www.facebook.com/morten.wilder/posts/10224074328432721:"
Banditterne i habitterne på slyngelborgen - Bødetakster for at overtræde restriktioner som følge af COVID-19 👎👎- Og med trusler, bøder og alverdens vil de få folket til at makke ret eller de fleste.

IKKE NOK MED FOLK SKAL VÆRE BANGE FOR VIRUS - SÅ SKAL DE OGSÅ VÆRE BANGE FOR DERES SYSTEM.

Det er jo fuldstændigt forrykt med det system her og dets håndlangere "systemets rockere"

Har måtte anmelde det til politiet, at der er nogen der går og laver rockeropkrævning og giver dummebøder osv.

Nåå det er også dem der er de rockere politiet?? yes, yes...hmm..... what to do?? 🤔🤔🤔 men shit hvor er jeg træt af dette pis de har gang i konstant.

Og nåå ja, er du formodet syg/smittet, så skal du jo også have en bøde, hvis du nægter at lade dig teste osv. Så er det man husker og strække armen op i vejret, som en vis fortid.

""Undladelse af at efterkomme et påbud om undersøgelse, indlæggelse, isolation eller behandlingBøden for at overtræde et påbud om at lade sig undersøge, indlægge, isolere eller behandle på grund af smitte eller formodet smitte med COVID-19 er fastsat til 3.500 kr""

Læs mere om deres bøder her.
Bødetakster for at overtræde restriktioner som følge af COVID-19
https://politi.dk/coronavirus-i-danmark/spoergsmaal-og-svar/boedetakster-for-at-overtraede-restriktioner?fbclid=IwAR2zAMXvmZ5l4OLvwXpaQtYUq8Buv-_AZADtnNQpe2OVomAv1oMA-FvP7Aw

Og med trusler, bøder og alverdens vil de få folket til at makke ret....eller de fleste, det er noget man har set den seneste tid flere steder her i del af verden

Italien indfører nogle af verdens strammeste coronaregler - brud kan udløse gigantbøder og fængsel
https://nyheder.tv2.dk/udland/2020-10-07-italien-indfoerer-nogle-af-verdens-strammeste-coronaregler-brud-kan-udloese?fbclid=IwAR0NCRddkBN0bxJ0g9WkzWpXjwH1U6YSlStw9DNRYArWmcZ8REHJzNIvQnU

Boris Johnson truer i tv-tale til folket med om nødvendigt at indsætte hæren?https://www.facebook.com/morten.wilder/videos/10223973637915521/

Og nu også i landet her med flere bøder og større....
Det går sgu godt for dem."

"Demonstration ved Folketingets åbning 6. oktober 2020

Da Folketinget åbnede tirsdag den 6. oktober 2020, var der demonstrationer og taler i løbet af dagen.

Blandt andet havde Antikrigsbevægelsen "TID TIL FRED – aktiv mod krig" repræsentanter fra en række forskellige organisationer på scenen.

Arrangementet blev afholdt under parolen "Bedre levevilkår til alle – ingen kroner til krig og kanoner".

Blandt talerne var Brian Vilhelm Bjørnsøn fra FredsVagten.

Se mere dkdox.tv på:

http://www.dkdox.tv
http://www.facebook.com/dkdox.tv/

Abonner gratis her:

http://www.youtube.com/channel/UC03g0...

Støt dkdox.tv:

https://www.subscribestar.com/dkdox-tv
https://www.gofundme.com/support-dkdoxtv

Kontakt dkdox.tv:
[email protected]

DK20068
Genre: Update".

9 months, 3 weeks ago

Corona PCR Tests, False Positives, Validation, Cycles / Amplification and Operation Moonshot - with Dr. Kaufman and David Icke

9 months, 4 weeks ago

"Danish: Caterine Schaal Kræver friheden tilbage" (dkdox.tv, 30. september 2020):
https://www.youtube.com/watch?v=kQQrdaW_KOQ

""Fællesskab for frihed" Demonstration d.26.09.20

Update var tilstede på Christiansborg Slotsplads da demonstrationen "Fællesskab for frihed" blev afholdt.

Demonstrationen var arrangeret af Frihedsbevægelsens Fællesråd og dækkede temaerne frihedsindgreb, hastelove, misinformation, rettigheder og det menneskelige frie valg.

Dette er Caterine Schaals tale fra dagen.

Se mere dkdox.tv på:

http://www.dkdox.tv
http://www.facebook.com/dkdox.tv/

Abonner gratis her:

http://www.youtube.com/channel/UC03g0...

Støt dkdox.tv:

https://www.subscribestar.com/dkdox-tv
https://www.gofundme.com/support-dkdoxtv

Kontakt dkdox.tv:
[email protected]

DK20063
Genre: Update".

10 months ago

This video demonstrates that there is a relatively safe mutation of COVID-19 that has been circulating since at least the 25th February 2020.
It is presumably going unnoticed in almost all infected people and is inadvertently immunising them against the other more dangerous versions of the virus.

I discover the odd mistake in videos after I make them. This means I might remake videos in the light of new information.
But the gist of all these videos is correct and that is why they are left up.
The one detail I don't like in this one is I talk about the "replication rate" when really (although I guess it does affect how fast it replicates in the human body) the mutation in question is more specifically affecting the affinity of the spike protein to the ACE2 receptor. But the gist of the video is about right.

Another video giving other useful information including an explanation of why we have "flu season" and how things are likely to go in the next few months is...
https://www.bitchute.com/video/V4xbCqMtx0Tc/

I just (after publishing this video) found a PDF published by the Lancet August 29th saying roughly what my video says though lacking my reference to the law and the efficacy of ignoring certain outbreaks (using the harmless mutation as a free vaccine). It also fails to convey just how much less lethal some outbreaks have been compared to others.
https://www.thelancet.com/pdfs/journals/lancet/PIIS0140-6736(20)31757-8.pdf

One key bit of text on the 2nd page of the PDF is as follows...
"Implications of all the available evidence
ORF8 is a hotspot for coronavirus mutation. The clinical effect
of deletions in this region appears to be a milder infection with
less systemic release of proinflammatory cytokines and a more
effective immune response to SARS-CoV-2"

This is another reason for it being milder other than the previously described mutation that makes successful docking of the virion on the receptor more hit and miss. But it is talking about the exact same strains.
It could also be that there are fewer infected cells at a time due to the previously described mutation and therefore fewer cytokines released.

I can't stress the significance of this issue strongly enough.
You are ignoring important information and parroting nonsense such as morbidity rates that take account of people who never had COVID-19.
Nobody (except tax payers) has a financial interest in pointing out the benefits of letting the non lethal strains of COVID immunise people free of charge.

The idea is never going to be suggested by anyone except you taxpayers so that is why you need to understand this.

This has had 18 views in just over half a day.
This is like leading a horse to water and watching it die of thirst.

Here is a link to the WHO bulletin...
https://www.who.int/bulletin/volumes/98/7/20-253591.pdf
This link is for an article about how various strains of COVID vary not just in terms of how infectious COVID is but also in terms of lethality too.
https://debuglies.com/2020/05/05/a-new-sars-cov-2-mutation-cancels-81-letters-from-the-genome-what-will-be-the-consequences/
This link is to the Public Health (Control of Disease) Act 1984...
https://www.legislation.gov.uk/ukpga/1984/22/introduction

This has been a well understood fact by a small number of scientists since at least the 5th of May 2020 but it is not part of the mainstream narrative so the knowledge is going to need to be pushed out there despite the best efforts of interfering busy bodies in our governments and on social media platforms such as Facebook and Twitter.

I make the suggestion that perhaps we should be discouraging the morons who run our country from combatting this "free of charge vaccine".

I first predicted the emergence of this over a month ago though I did not realise at that time just how readily these viruses mutate.

https://www.bitchute.com/john-morley/
https://vk.com/johnmorley
https://www.minds.com/JohnMorley/
https://parler.com/profile/Johnmorleyuk/
https://twitter.com/JohnMor66719851

10 months, 1 week ago