#tom-cowan

EVEN ATTACKS BY MEANS OF NEGATIVE REVIEWS CANNOT STOP THE TRUTH TO BE EXPOSED
================================================================================
ENGLISH
Tim Truth
Join our leading researchers on https://GroupDiscover.com to find the best videos from across the censorship-resistant internet platforms like Odysee, LBRY, Bitchute & Brighteon. Coupon code noforcedmeds 40% off, recurring discount! (limited time offer)

Add me on these great platforms: https://odysee.com/@TimTruth:b/ https://bitchute.com/timtruth/ https://GroupDiscover.com and https://flote.app/timtruth1

Brought to you by the great supporters of this channel who fund this research. Join us on Patreon https://www.patreon.com/timtruth for exclusive content, censored videos and to help me make this channel even better.
-------------------------------------------------------------------------------------------------------------------------------
Tägliche politische und Geoengineering-Nachrichten:
https://vk.com/chembuster

Meine Kanäle:
https://www.bitchute.com/channel/chembuster/
https://vimeo.com/chembuster

My personal greetings from Germany go to all patriots in the world:
https://www.bitchute.com/video/Eo3W38SBzzWn/

3 months, 1 week ago

Dr Tom Cowan talks through the dubious ideas of conventional virology and outlines his theories on what is really going on with inflammation, illness and diseases. Dr Andrew Kaufman's work is mentioned alongside attacks on germ theory and this ties in with Kaufman's recent revelations of Dr Stefan Lanka's apparent debunking of virology which you can see here: https://www.bitchute.com/video/XSFVgf3M5dUP/

4 months, 3 weeks ago

The video posted earlier cuts out at the 37.00 min mark. This one goes the full 1hr :08 mins.

Freedom Talk with Tom Cowan, Stefan Lanka, Andrew Kaufman & Dean - 04/03/2021

source: https://odysee.com/@Truth_will_set_You_Free:0/Freedom-Talk---4-March-2021:5

6 months, 2 weeks ago

Dr. Cowan breaks down the mechanisms of mRNA viruses, giving context to the ongoing COVID conundrum regarding the "vaccines." NOTE: He uses the word, "vacation" in place of "vaccine" because this video was initially uploaded to YouTube. Dr. Cowan's work is found on his BitChute channel @
https://www.bitchute.com/channel/CivTSuEjw6Qp/

Original video:
https://www.bitchute.com/video/KwsWrr27h4u5/
OR
https://www.youtube.com/watch?v=0f4xKbKVNXw

8 months ago

The article: https://off-guardian.org/2020/11/17/covid19-evidence-of-global-fraud/ .

Excerpt: .."The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find. The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2. However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes." ..

Read the comments / debate under the article, very informative and it reflects the confusion that (still) exists among many.

Dr. Cowan on Bitchute: https://www.bitchute.com/drtomcowan/

🍀🍀🍀🍀🍀

PROJECT IMMANUEL (critically examines and scrutinises all fundamental publications on Sars-CoV-2) (DR. STEFAN LANKA)
📌 https://bitchute.com/video/9pbsKaSjlfy2/

🍀🍀🍀🍀🍀

𝗦𝗧𝗔𝗧𝗘𝗠𝗘𝗡𝗧 𝗢𝗡 𝗩𝗜𝗥𝗨𝗦 𝗜𝗦𝗢𝗟𝗔𝗧𝗜𝗢𝗡 (𝗦𝗢𝗩𝗜)
🔔 https://drtomcowan.com/sovi

🍀🍀🍀🍀🍀

DR. COWAN & JON RAPPOPORT: SARS-COV-2 IS AN IMAGINARY VIRUS 🧚
➡️ https://bitchute.com/video/IqsL6wXHJAaP/

Dr. Cowan debunks peer reviewed papers on isolation sars-cov-2:
➡️ https://bitchute.com/video/jwQV79H88CBs/

Dr. Cowan on the inconsistencies in the covid story:
➡️ https://bitchute.com/video/3Gy2sddhd6b7/

HOW MANY PEOPLE ARE COVID (FALSE) POSITIVE? ZERO!! (DR. TOM COWAN)
➡️ https://bitchute.com/video/gZt4pzXI6vxc/

DR. COWAN EXPLAINS 'VIRUS MUTATIONS'
➡️ https://bitchute.com/video/xtcO2y9r5jNU/

🍀🍀🍀🍀🍀

DR. G. DOWNING: OUR DNA CODES UNDER ATTACK:
🔖 https://bitchute.com/video/3XOeWrdBCupb/

DER FALL DROSTEN - REINER FÜLLMICH / DAVE BRYCH:
🔖 https://bitchute.com/video/jzEMQw162APx/

CDC: A specimen of a real virus was never available:
🔖 https://bitchute.com/video/fr9v0GO64p35/

GEMMA O'DOHERTY > PROOF SARS-COV-2 DOES NOT EXIST.
🔖 https://bitchute.com/video/sERAbw5DxIYC/

🍀🍀🍀🍀🍀

Dr. Lanka - 'germ theory' = scientific fraud:
➡️ https://bitchute.com/video/aOKX9wR1PMxA/

Dr. Lanka Measles Court Case:
➡️ https://bitchute.com/video/5GINdlpUSW8E/

Dr. S. Lanka, The Infectious Myth:
➡️ https://bitchute.com/video/04pyhDltPrMU/

Louis Pasteur was a fraud:
➡️ https://bitchute.com/video/WUY46Y43Przw/

Aajonus Vonderplanitz dismantles the virus myth:
➡️ https://bitchute.com/video/UHFNVCXgOA37/

You cannot catch a virus! (Tom Barnett)
➡️ https://bitchute.com/video/VeImUAiLlmcv/

🍀🍀🍀🍀🍀

INFLUENZA 1918 SCRIPT; RINSE REPEAT > COVID-19:
➡️ https://bitchute.com/video/6eKF4nzGcXiP/

A. Kaufman: Koch's postulates:
➡️ https://bitchute.com/video/c94KOf6RsAnP/

MD OFFERS $5000 FOR PROOF THAT COVID EXISTS:
➡️ https://bitchute.com/video/cgjcIdY4mMhZ/

L. Scheff: what journalists get wrong: viruses / pandemics:
➡️ https://bitchute.com/video/KKmXt1b2YcsB/

L. Scheff: Vaccines, science or pseudo science?
➡️ https://bitchute.com/video/X4L7rrVQguU6/

🍀🍀🍀🍀🍀

Kary Mullis - PCR Test-not-a-test:
➡️ https://bitchute.com/video/LsD3GfigvsJX/

Dr. Willner injects himself with HIV:
➡️ https://bitchute.com/video/Yo5o98vppwIN/

DR GIRALDO - everybody is hiv positive!!
➡️ https://bitchute.com/video/nkMN1kr0eukR/

Deconstructing The AIDS Myth:
➡️ https://bitchute.com/video/2Q83yDG115oC/

House of Numbers - the HIV/AIDS story:
➡️ https://bitchute.com/video/lohmnsGaLy2X/

Dr. Köhnlein interview House of Numbers:
➡️ https://bitchute.com/video/FTytxqTeXNxe/

HIV / AIDS = FAUCI'S FIRST FRAUD:
➡️ https://bitchute.com/video/xwKIEPpPpmzv/

The Infectious Myth - David Crowe:
➡️ https://bitchute.com/video/QbjP8sO2qCq2/

Dr. Papadopulos: HIV was never proven:
➡️ https://bitchute.com/video/MVabU0seKNMH/

🍀🍀🍀🍀🍀

Virus Mania: C. Markolin, Ph.D. (pt.2)
➡️ https://bitchute.com/video/0SIeRUxrgW1n/

Virus Mania: C. Markolin, Ph.D. (pt.1)
➡️ https://bitchute.com/video/XRCxanRMLGkT/

Germs, The Terrain & our Future:
➡️ https://bitchute.com/video/0Hh4k27cXPxv/

9 months, 1 week ago